TkA02G586850 | RubberDandelionOmics

Gene overview

TkA02G586850

Reference: TK1151 Chr: Chr02 Coordinates: 151415633-151416894 Strand: - Type: protein_coding

cDNA / CDS / Protein Sequences

Available sequence downloads CDS FASTA Protein FASTA cDNA FASTA

cDNA

1074 bp · TkA02G586850|TK1151|cDNA

ATGTGGGATCAGGTCTTGCACCTTCACCCCCCTTTCGGTTCGACGTCCCCGTCGAACATCGGCCCGTGCCCTGGCTCTGATACCATTTGTAACGACCCCGCTTACCGGGAATCGCTGCGCCCGGCTGACCCCGGGACACTGGCACGTATCAAGATATTGTCCGCTTTGGGCTATCTCCCTCACGGATTTAAAACGCGTCTTGCCGAAAGGGATAGATGGTATACTGCCGAAAATTTGATCGATCAAGATGAAGAGTTCTT...

CDS

Download CDS FASTA

1074 bp · TkA02G586850|TK1151|CDS

ATGTGGGATCAGGTCTTGCACCTTCACCCCCCTTTCGGTTCGACGTCCCCGTCGAACATCGGCCCGTGCCCTGGCTCTGATACCATTTGTAACGACCCCGCTTACCGGGAATCGCTGCGCCCGGCTGACCCCGGGACACTGGCACGTATCAAGATATTGTCCGCTTTGGGCTATCTCCCTCACGGATTTAAAACGCGTCTTGCCGAAAGGGATAGATGGTATACTGCCGAAAATTTGATCGATCAAGATGAAGAGTTCTT...

Protein

Download Protein FASTA

357 aa · TkA02G586850|TK1151|PROTEIN

MWDQVLHLHPPFGSTSPSNIGPCPGSDTICNDPAYRESLRPADPGTLARIKILSALGYLPHGFKTRLAERDRWYTAENLIDQDEEFFEITAEIYNRKKSELKKLVTKLTNMHEALAKQNVQLIKEVSKNTHKSTAPIKTQQVGSSSSTSLQVFQTNKIDKIGYEFDLNNPGGGFNFSTKEVPESSVSVSSNSKSESFMSTNDHLNSPVKNDASGVKEDEISKLKEELPTKVILHTELVSTLKSMEKTSDLLNEQFNLQQA...

Flanking Sequence Download

Sequence orientation and download details

Upstream/downstream are capped at 10000 bp per side. Negative-strand genes are reverse-complemented so the final FASTA follows transcriptional 5′→3′ orientation.

ID Mapping

Input ID	`TkA02G586850`
TK1151 ID	TkA02G586850
OH-1004 ID	LXL04_012115
Relationship / confidence	Multi Source To Oh1004 / Complex relationship
Protein identity (%)	82.600
Protein coverage (%)	TK1151 92.157 / OH-1004 99.250 Coverage and evidence Coverage is the aligned span of the best-scoring HSP divided by representative protein length. A homolog match does not establish functional validation.
Source version	TK1151 / GWHBCHF00000000

Open Full ID Mapping

SNP / Indel variants and carrier samplesCRA009020 · TK1151

Expand to load variant records for this gene.

Basic Information and Functional Annotation

Gene ID	`TkA02G586850`
Location	Chr02:151415633-151416894 (-)
Description	Protein of unknown function
Arabidopsis / Rice Reference Genes and Papers	Download references for this gene Arabidopsis No hit for this species in the current source table. Rice No hit for this species in the current source table.
Functional annotation source	View annotation sources Functional annotation source: OH1004 · `LXL04_012115` · GCA_047496595.1_OSU_TarKok_2.0. These OH1004 annotations are retrieved through ID mapping; the Arabidopsis/rice table below uses protein alignments from the query reference.
GO annotations (OH1004 source)	No functional description available
KEGG gene cross-reference	No functional description available

Open Annotation Module

Gene expression

View expression in different studies, tissues and treatments. Results are presented separately by study and measurement unit.

View expression for this gene

Data sources and gene correspondence

Expression data come from public transcriptome studies. Reference genomes, sample metadata and measurement units are shown with the results. Ambiguous cross-reference correspondences do not select an expression record automatically; missing values do not mean zero expression.

Subcellular Localization Top 5

Computational predictions or homology annotations below do not replace localization experiments.

Cytoplasm0.581

Rank 1 · TkA02G586850 · TK1151

Nucleus0.346

Rank 2 · TkA02G586850 · TK1151

Cell membrane0.055

Rank 3 · TkA02G586850 · TK1151

Mitochondrion0.052

Rank 4 · TkA02G586850 · TK1151

Golgi apparatus0.041

Rank 5 · TkA02G586850 · TK1151

LocPro · Direct prediction · Computational prediction, not experimental localization

Open Subcellular Module

Predicted Functional Domains

Domain results are from Pfam-A/HMMER; positions are amino-acid coordinates on the protein sequence.

PF07765KIP178-118 aa

PF16046FAM7678-129 aa

PF02752Arrestin_C85-152 aa

PF06785UPF024291-138 aa

PF08614ATG16104-148 aa

PF08614ATG16187-294 aa

PF16046FAM76188-341 aa

PF07765KIP1194-255 aa

Gene ID	Domain ID	Domain Name	Start aa	End aa	E-value	Score
TkA02G586850	`PF07765`	KIP1	78	118	0.00031	21.5
TkA02G586850	`PF16046`	FAM76	78	129	0.0028	17.9
TkA02G586850	`PF02752`	Arrestin_C	85	152	0.032	15.3
TkA02G586850	`PF06785`	UPF0242	91	138	0.014	16.2
TkA02G586850	`PF08614`	ATG16	104	148	1.6	9.6
TkA02G586850	`PF08614`	ATG16	187	294	1.6	9.6
TkA02G586850	`PF16046`	FAM76	188	341	0.0028	17.9
TkA02G586850	`PF07765`	KIP1	194	255	0.00031	21.5
TkA02G586850	`PF06785`	UPF0242	214	294	0.014	16.2
TkA02G586850	`PF02752`	Arrestin_C	308	319	0.032	15.3
TkA02G586850	`PF06785`	UPF0242	316	346	0.014	16.2

Arabidopsis / Rice Protein Homology

Only Arabidopsis and rice are shown. Swiss-Prot entries are reviewed; TrEMBL entries are supplementary sequence candidates. Similarity is not experimental validation.

Download current result

No result was found for this query.

JBrowse

View in Genome Browser

Gene Card