TkA02G584000 | RubberDandelionOmics

Gene overview

TkA02G584000

Reference: TK1151 Chr: Chr02 Coordinates: 150698746-150702685 Strand: + Type: protein_coding

cDNA / CDS / Protein Sequences

Available sequence downloads CDS FASTA Protein FASTA cDNA FASTA

cDNA

1981 bp · TkA02G584000|TK1151|cDNA

CACGACTGTAATTGTATGAATTACTGTACGACTCAGATCTGTGGGATGGTTATTGGTTAAACAGAAGACGATAGAGGTGCGGATTTTCTCCTTATCTTTATTTTATCCAAATTCCAAACCCTTTTTAACTCATCAAAGAAACAATCCATTCCTATTCCGAAATGCCCACTAAATTCAACTCCTAAAAGAGCGAAATTCTTAAGAAAATCTTCCCAACACCATGTCAACTATGTACAGTTATTCGGTTCCTTCTTTCTCCT...

CDS

Download CDS FASTA

1191 bp · TkA02G584000|TK1151|CDS

ATGTCAACTATGTACAGTTATTCGGTTCCTTCTTTCTCCTCGATCTCCCTTTCCAATTTTACTTATCGTCGCCCAAATCGCATCATCTGCTCCGCTGGAGCACCTGTTGCAGAACGAAAAGCCATCAATACAACTGAACCACTATTACTGAATGCTGTTCGTGGTGAAGATGTAGAAAGACCCCCAGTTTGGCTTATGAGACAAGCAGGGAGGTACATGAAGAGTTATCAAACCTTATGTGAAAAGTATCCTTCCTTTCG...

Protein

Download Protein FASTA

396 aa · TkA02G584000|TK1151|PROTEIN

MSTMYSYSVPSFSSISLSNFTYRRPNRIICSAGAPVAERKAINTTEPLLLNAVRGEDVERPPVWLMRQAGRYMKSYQTLCEKYPSFRERSENVDLVVEISLQPWKVFQPDGVILFSDILTPLPGMNIPFDIVKGKGPIIFDPISTAAQVDQVREFTPQEWVPYVGEALTILRKEVNNEAAVLGFVGAPFTLASYVVEGGSSKNFTKIKKLAFSQPEVLHALLEKFTTSMAKYIQYQADNGAQAVQIFDSWATELSPTDFE...

Flanking Sequence Download

Sequence orientation and download details

Upstream/downstream are capped at 10000 bp per side. Negative-strand genes are reverse-complemented so the final FASTA follows transcriptional 5′→3′ orientation.

ID Mapping

Input ID	`TkA02G584000`
TK1151 ID	TkA02G584000
OH-1004 ID	LXL04_012170
Relationship / confidence	Rbh High Identity Coverage Synteny / Strict
Protein identity (%)	99.200
Protein coverage (%)	TK1151 97.727 / OH-1004 100.000 Coverage and evidence Coverage is the aligned span of the best-scoring HSP divided by representative protein length. A homolog match does not establish functional validation.
Source version	TK1151 / GWHBCHF00000000

Open Full ID Mapping

SNP / Indel variants and carrier samplesCRA009020 · TK1151

Expand to load variant records for this gene.

Basic Information and Functional Annotation

Gene ID TkA02G584000

Location Chr02:150698746-150702685 (+)

Description Similar to Os03g0337600: Uroporphyrinogen decarboxylase 2, chloroplastic

Arabidopsis / Rice Reference Genes and Papers

Download references for this gene

Arabidopsis

Reference gene ID	Possible function	Papers / DOI
`At2g40490`	Catalyzes the decarboxylation of four acetate groups of uroporphyrinogen-III to yield coproporphyrinogen-III.	No verified direct reference in this release

Rice

Reference gene ID	Possible function	Papers / DOI
`Os03g0337600`	Catalyzes the decarboxylation of four acetate groups of uroporphyrinogen-III to yield coproporphyrinogen-III.	No verified direct reference in this release

Functional annotation source

View annotation sources

Functional annotation source: OH1004 · LXL04_012170 · GCA_047496595.1_OSU_TarKok_2.0. These OH1004 annotations are retrieved through ID mapping; the Arabidopsis/rice table below uses protein alignments from the query reference.

GO annotations (OH1004 source)

GO:0006782 protoporphyrinogen IX biosynthetic process Biological Process

GO:0015995 chlorophyll biosynthetic process Biological Process

GO:0005794 Golgi apparatus Cellular Component

GO:0009507 chloroplast Cellular Component

GO:0009570 chloroplast stroma Cellular Component

GO:0009941 chloroplast envelope Cellular Component

GO:0004853 uroporphyrinogen decarboxylase activity Molecular Function

KEGG gene cross-reference

ath:AT2G40490

dosa:Os03g0337600

nta:107813684

These KEGG gene identifiers are linked through homologous proteins; they do not establish pathway function for this gene.

Open Annotation Module

Gene expression

View expression in different studies, tissues and treatments. Results are presented separately by study and measurement unit.

View expression for this gene

Data sources and gene correspondence

Expression data come from public transcriptome studies. Reference genomes, sample metadata and measurement units are shown with the results. Ambiguous cross-reference correspondences do not select an expression record automatically; missing values do not mean zero expression.

Subcellular Localization Top 5

Computational predictions or homology annotations below do not replace localization experiments.

Plastid0.967

Rank 1 · TkA02G584000 · TK1151

Mitochondrion0.058

Rank 2 · TkA02G584000 · TK1151

Cytoplasm0.036

Rank 3 · TkA02G584000 · TK1151

Peroxisome0.026

Rank 4 · TkA02G584000 · TK1151

Nucleus0.015

Rank 5 · TkA02G584000 · TK1151

LocPro · Direct prediction · Computational prediction, not experimental localization

Open Subcellular Module

Predicted Functional Domains

Domain results are from Pfam-A/HMMER; positions are amino-acid coordinates on the protein sequence.

PF01208URO-D46-383 aa

Gene ID	Domain ID	Domain Name	Start aa	End aa	E-value	Score
TkA02G584000	`PF01208`	URO-D	46	383	1.1e-122	410.2

Arabidopsis / Rice Protein Homology

Only Arabidopsis and rice are shown. Swiss-Prot entries are reviewed; TrEMBL entries are supplementary sequence candidates. Similarity is not experimental validation.

Download current result

Protein	Organism	Description	Identity	Database	Confidence
`O22886`	Arabidopsis thaliana	sp\|O22886\|DCUP2_ARATH Uroporphyrinogen decarboxylase 2, chloroplastic	83.600%	Swiss-Prot	High
`Q10LR9`	Oryza sativa subsp. japonica	sp\|Q10LR9\|DCUP2_ORYSJ Uroporphyrinogen decarboxylase 2, chloroplastic	83.400%	Swiss-Prot	High

JBrowse

View in Genome Browser

Gene Card