TkA02G583640 | RubberDandelionOmics

Gene overview

TkA02G583640

Reference: TK1151 Chr: Chr02 Coordinates: 150572639-150574628 Strand: - Type: protein_coding

cDNA / CDS / Protein Sequences

Available sequence downloads CDS FASTA Protein FASTA cDNA FASTA

cDNA

1098 bp · TkA02G583640|TK1151|cDNA

CTTAAACAATACTTATCACCTTCATCATTTTCTTCATTATTTTCATCTTATAAGTTTTCCTTCTTCAGTTCTTCAAATTTTCTGTTGGTTTCATAATCTTGATATTTGGCACCTTTTTATAAAAAACAAAAAAAATACATGGATTGCTCATTATGTACCACGATGCCATATAATTTGAGGCCTCCAAGGAACACCATATGTGTAGCTTGTTATGAAGGTGCCAAATGTATTATCGCCATGACTAACAAGATTGATATTGA...

CDS

Download CDS FASTA

819 bp · TkA02G583640|TK1151|CDS

ATGGATTGCTCATTATGTACCACGATGCCATATAATTTGAGGCCTCCAAGGAACACCATATGTGTAGCTTGTTATGAAGGTGCCAAATGTATTATCGCCATGACTAACAAGATTGATATTGATCATAAGATTTCTGGGAAATTATCCGGTGATGCGCCCCTTCCTGGTTCTTCTTCTTCCAAGGGTTTCTTGAGTTCTTTGAAATGGTTGAAGGAGATGAAGAGGATGGAAGAAGAAATGAATCATAAAATGGGGTTTTT...

Protein

Download Protein FASTA

272 aa · TkA02G583640|TK1151|PROTEIN

MDCSLCTTMPYNLRPPRNTICVACYEGAKCIIAMTNKIDIDHKISGKLSGDAPLPGSSSSKGFLSSLKWLKEMKRMEEEMNHKMGFLSGFMDAFRDAIHTDILIKPGNDAPSIPAHRALLATRSNIFRNMLDSDGCKAAPNDTITLPELNHEEVESLLEFLYSGDLAKEKLDKHLYSLSIAADKYEIPFLQKFCENRMLEVLNTNNALDILEISDTTCNRNLKETALSFVVKNMEDIVFAARFDVFALKNPHLTVQITRA...

Flanking Sequence Download

Sequence orientation and download details

Upstream/downstream are capped at 10000 bp per side. Negative-strand genes are reverse-complemented so the final FASTA follows transcriptional 5′→3′ orientation.

ID Mapping

Input ID	`TkA02G583640`
TK1151 ID	TkA02G583640
OH-1004 ID	LXL04_012177
Relationship / confidence	Rbh High Identity Coverage Synteny / Strict
Protein identity (%)	100.000
Protein coverage (%)	TK1151 100.000 / OH-1004 100.000 Coverage and evidence Coverage is the aligned span of the best-scoring HSP divided by representative protein length. A homolog match does not establish functional validation.
Source version	TK1151 / GWHBCHF00000000

Open Full ID Mapping

SNP / Indel variants and carrier samplesCRA009020 · TK1151

Expand to load variant records for this gene.

Basic Information and Functional Annotation

Gene ID TkA02G583640

Location Chr02:150572639-150574628 (-)

Description Similar to At3g56230: BTB/POZ domain-containing protein At3g56230

Arabidopsis / Rice Reference Genes and Papers

Download references for this gene

Arabidopsis

Reference gene ID	Possible function	Papers / DOI
`At3g56230`	May act as a substrate-specific adapter of an E3 ubiquitin-protein ligase complex (CUL3-RBX1-BTB) which mediates the ubiquitination and subsequent proteasomal degradation of target proteins.	No verified direct reference in this release
`At1g01640`	May act as a substrate-specific adapter of an E3 ubiquitin-protein ligase complex (CUL3-RBX1-BTB) which mediates the ubiquitination and subsequent proteasomal degradation of target proteins.	No verified direct reference in this release
`At5g48510`	May act as a substrate-specific adapter of an E3 ubiquitin-protein ligase complex (CUL3-RBX1-BTB) which mediates the ubiquitination and subsequent proteasomal degradation of target proteins.	No verified direct reference in this release

Rice

No hit for this species in the current source table.

Functional annotation source

View annotation sources

Functional annotation source: OH1004 · LXL04_012177 · GCA_047496595.1_OSU_TarKok_2.0. These OH1004 annotations are retrieved through ID mapping; the Arabidopsis/rice table below uses protein alignments from the query reference.

GO annotations (OH1004 source)

GO:0016567 protein ubiquitination Biological Process

GO:0005634 nucleus Cellular Component

GO:0005737 cytoplasm Cellular Component

KEGG gene cross-reference

ath:AT1G01640

ath:AT2G40450

ath:AT3G56230

ath:AT4G04090

These KEGG gene identifiers are linked through homologous proteins; they do not establish pathway function for this gene.

Open Annotation Module

Gene expression

View expression in different studies, tissues and treatments. Results are presented separately by study and measurement unit.

View expression for this gene

Data sources and gene correspondence

Expression data come from public transcriptome studies. Reference genomes, sample metadata and measurement units are shown with the results. Ambiguous cross-reference correspondences do not select an expression record automatically; missing values do not mean zero expression.

Subcellular Localization Top 5

Computational predictions or homology annotations below do not replace localization experiments.

Cytoplasm0.628

Rank 1 · TkA02G583640 · TK1151

Nucleus0.374

Rank 2 · TkA02G583640 · TK1151

Mitochondrion0.083

Rank 3 · TkA02G583640 · TK1151

Cell membrane0.076

Rank 4 · TkA02G583640 · TK1151

Endoplasmic reticulum0.046

Rank 5 · TkA02G583640 · TK1151

LocPro · Direct prediction · Computational prediction, not experimental localization

Open Subcellular Module

Predicted Functional Domains

Domain results are from Pfam-A/HMMER; positions are amino-acid coordinates on the protein sequence.

PF24634DUF763118-31 aa

PF00651BTB95-198 aa

PF21536BTB_KLHL33135-186 aa

PF24634DUF7631170-189 aa

PF07707BACK180-201 aa

PF07707BACK208-243 aa

PF24634DUF7631217-235 aa

Gene ID	Domain ID	Domain Name	Start aa	End aa	E-value	Score
TkA02G583640	`PF24634`	DUF7631	18	31	0.56	11.4
TkA02G583640	`PF00651`	BTB	95	198	9.7e-19	68.3
TkA02G583640	`PF21536`	BTB_KLHL33	135	186	0.00093	19.7
TkA02G583640	`PF24634`	DUF7631	170	189	0.56	11.4
TkA02G583640	`PF07707`	BACK	180	201	0.14	13.0
TkA02G583640	`PF07707`	BACK	208	243	0.14	13.0
TkA02G583640	`PF24634`	DUF7631	217	235	0.56	11.4

Arabidopsis / Rice Protein Homology

Only Arabidopsis and rice are shown. Swiss-Prot entries are reviewed; TrEMBL entries are supplementary sequence candidates. Similarity is not experimental validation.

Download current result

Protein	Organism	Description	Identity	Database	Confidence
`Q9LYL9`	Arabidopsis thaliana	sp\|Q9LYL9\|Y3623_ARATH BTB/POZ domain-containing protein At3g56230	48.600%	Swiss-Prot	Medium
`Q9LQ95`	Arabidopsis thaliana	sp\|Q9LQ95\|Y1164_ARATH BTB/POZ domain-containing protein At1g01640	46.900%	Swiss-Prot	Medium
`Q9LV63`	Arabidopsis thaliana	sp\|Q9LV63\|Y5851_ARATH BTB/POZ domain-containing protein At5g48510	33.500%	Swiss-Prot	Medium

JBrowse

View in Genome Browser

Gene Card