TkA02G576830 | RubberDandelionOmics

Gene overview

TkA02G576830

Reference: TK1151 Chr: Chr02 Coordinates: 148820469-148822923 Strand: - Type: protein_coding

cDNA / CDS / Protein Sequences

Available sequence downloads CDS FASTA Protein FASTA cDNA FASTA

cDNA

1582 bp · TkA02G576830|TK1151|cDNA

CTCAAATCGGTTATAAGTTTGGATGTATAGATCTAGTAAGTTTCAAACTTAGTCAACGATTTGACTAAGCCGTACCTATTCACAAACAATAAAGTTCTCCGCTTCTAACTGAATCGCCAACACAGGCATCGTTTCCTTCAAACGGAATCATCACCCACTCCGCCCATCTCCGCTGTCAATCACCATAGCCAAAATATAAAATTTAAGTAGGGCAAGAAGATACCTAAAGGATATCTAGAGAGAGATAGAGGGGGTTGTGG...

CDS

Download CDS FASTA

993 bp · TkA02G576830|TK1151|CDS

ATGGTGGCCAGGACAAGCCTAATTAACCGTCGGACTGCGCAGAAGTTCCGGCAAGCAGCGATCTCGGCCGCTGGCTCACTCAAGATCAAGCTGTTACTGTTTTGTTGCTTCGTCTTTACATTAACCTTGCTCGCAAGCCGAACGCCGTCGTTTTTGGGTTGGGGACAAGAGAGTGTTCCCCTTCTTGATCGGAATTCCAGGAAAGGGTATACATTACTGATAAACACATGGAAACGATATGATCTTCTCAAGCAATCGAT...

Protein

Download Protein FASTA

330 aa · TkA02G576830|TK1151|PROTEIN

MVARTSLINRRTAQKFRQAAISAAGSLKIKLLLFCCFVFTLTLLASRTPSFLGWGQESVPLLDRNSRKGYTLLINTWKRYDLLKQSISHYTSCPRLDSIHIVWSEPNPPSDALIKYLNHAVKSNTGDNRHIELAFDINKEDSLNNRFKEIKNPITDAVFSIDDDIIFTCKSVEFAFSVWQSAPDTMVGFVPRIHLINPSKGNENSYIYGGWWPVWWTGTYSMILSKASFFHMKYLRLYTNEMPKSLMEYVKRNRNCEDIA...

Flanking Sequence Download

Sequence orientation and download details

Upstream/downstream are capped at 10000 bp per side. Negative-strand genes are reverse-complemented so the final FASTA follows transcriptional 5′→3′ orientation.

ID Mapping

Input ID	`TkA02G576830`
TK1151 ID	TkA02G576830
OH-1004 ID	LXL04_012275
Relationship / confidence	Rbh High Identity Coverage Synteny / Strict
Protein identity (%)	99.700
Protein coverage (%)	TK1151 100.000 / OH-1004 100.000 Coverage and evidence Coverage is the aligned span of the best-scoring HSP divided by representative protein length. A homolog match does not establish functional validation.
Source version	TK1151 / GWHBCHF00000000

Open Full ID Mapping

SNP / Indel variants and carrier samplesCRA009020 · TK1151

Expand to load variant records for this gene.

Basic Information and Functional Annotation

Gene ID TkA02G576830

Location Chr02:148820469-148822923 (-)

Description Similar to EPC1: Glycosyltransferase family 64 protein C4

Arabidopsis / Rice Reference Genes and Papers

Download references for this gene

Arabidopsis

Reference gene ID	Possible function	Papers / DOI
`At3g55830`	Mannosyl transferase (ManT) required for the biosynthesis of mannose-carrying glycosylinositol phosphorylceramides (GIPCs).	Cell adhesion in Arabidopsis thaliana is mediated by ECTOPICALLY PARTING CELLS 1--a glycosyltransferase (GT64) related to the animal exostosins.2005 · DOI: 10.1111/j.1365-313x.2005.02455.x Loss of Inositol Phosphorylceramide Sphingolipid Mannosylation Induces Plant Immune Responses and Reduces Cellulose Content in Arabidopsis.2016 · DOI: 10.1105/tpc.16.00186

Rice

No hit for this species in the current source table.

Functional annotation source

View annotation sources

Functional annotation source: OH1004 · LXL04_012275 · GCA_047496595.1_OSU_TarKok_2.0. These OH1004 annotations are retrieved through ID mapping; the Arabidopsis/rice table below uses protein alignments from the query reference.

GO annotations (OH1004 source)

GO:0000271 polysaccharide biosynthetic process Biological Process

GO:0001503 ossification Biological Process

GO:0006024 glycosaminoglycan biosynthetic process Biological Process

GO:0006044 N-acetylglucosamine metabolic process Biological Process

GO:0006487 protein N-linked glycosylation Biological Process

GO:0006665 sphingolipid metabolic process Biological Process

GO:0006688 glycosphingolipid biosynthetic process Biological Process

GO:0008217 regulation of blood pressure Biological Process

GO:0009626 plant-type hypersensitive response Biological Process

GO:0009737 response to abscisic acid Biological Process

GO:0009738 abscisic acid-activated signaling pathway Biological Process

GO:0010087 phloem or xylem histogenesis Biological Process

KEGG gene cross-reference

ath:AT3G55830

hsa:2132

mmu:14043

mmu:58193

These KEGG gene identifiers are linked through homologous proteins; they do not establish pathway function for this gene.

Open Annotation Module

Gene expression

View expression in different studies, tissues and treatments. Results are presented separately by study and measurement unit.

View expression for this gene

Data sources and gene correspondence

Expression data come from public transcriptome studies. Reference genomes, sample metadata and measurement units are shown with the results. Ambiguous cross-reference correspondences do not select an expression record automatically; missing values do not mean zero expression.

Subcellular Localization Top 5

Computational predictions or homology annotations below do not replace localization experiments.

Golgi apparatus0.845

Rank 1 · TkA02G576830 · TK1151

Endoplasmic reticulum0.116

Rank 2 · TkA02G576830 · TK1151

Cytoplasm0.057

Rank 3 · TkA02G576830 · TK1151

Cell membrane0.036

Rank 4 · TkA02G576830 · TK1151

Extracellular0.032

Rank 5 · TkA02G576830 · TK1151

LocPro · Direct prediction · Computational prediction, not experimental localization

Open Subcellular Module

Predicted Functional Domains

Domain results are from Pfam-A/HMMER; positions are amino-acid coordinates on the protein sequence.

PF09258Glyco_transf_6470-321 aa

Gene ID	Domain ID	Domain Name	Start aa	End aa	E-value	Score
TkA02G576830	`PF09258`	Glyco_transf_64	70	321	5e-75	252.7

Arabidopsis / Rice Protein Homology

Only Arabidopsis and rice are shown. Swiss-Prot entries are reviewed; TrEMBL entries are supplementary sequence candidates. Similarity is not experimental validation.

Download current result

Protein	Organism	Description	Identity	Database	Confidence
`Q9LY62`	Arabidopsis thaliana	sp\|Q9LY62\|GMT1_ARATH Glycosylinositol phosphorylceramide mannosyl transferase 1	66.100%	Swiss-Prot	High

JBrowse

View in Genome Browser

Gene Card