TkA02G569930 | RubberDandelionOmics

Gene overview

TkA02G569930

Reference: TK1151 Chr: Chr02 Coordinates: 147224890-147227554 Strand: - Type: protein_coding

cDNA / CDS / Protein Sequences

Available sequence downloads CDS FASTA Protein FASTA cDNA FASTA

cDNA

1241 bp · TkA02G569930|TK1151|cDNA

CCACTTCTTTCTAGGGCACGGCTAAACAGTCTCAGGCTCTAAAATTTTCGATTTGAGCATCTGGATCTACCAACCTCTTTACGTGTCGATTCCCGGAATCGTTCTTGCCATTGCTCAGATTTCTGGAGAAGTTGGGGGTCCTATTTTGTTTCTATAAGTCGAAAATTATTCGTAAGGTTGAACCATGCGGGGATACAGTCCACCATACCACAGTCCTCCACGGAGAGGACATGGAGGTCGACCAAGAAGTCCTCCCAGAA...

CDS

Download CDS FASTA

756 bp · TkA02G569930|TK1151|CDS

ATGCGGGGATACAGTCCACCATACCACAGTCCTCCACGGAGAGGACATGGAGGTCGACCAAGAAGTCCTCCCAGAAGGGGACACGGTGGTGAGCGAGGGAGGCACAAGGATCAGAATCATGGCAGCCTTTTGGTTCGTAATATACCACTAAATTGCAGGGCTGAAGAGCTTCGTGTCCCATTTGAAAGGTTTGGAGTGGTCAGAGATGTCTATCTTCCAAAAAATTATTACACGGGGGAACCACGTGGGTTTGCATTTGT...

Protein

Download Protein FASTA

251 aa · TkA02G569930|TK1151|PROTEIN

MRGYSPPYHSPPRRGHGGRPRSPPRRGHGGERGRHKDQNHGSLLVRNIPLNCRAEELRVPFERFGVVRDVYLPKNYYTGEPRGFAFVQFVDAYDAGEAQYHMNGRMFAGREISVVLASESRKRPEEMRRRTRPRESEGRRSYHGRSRSRSRSPRRPSGSRSRQRSRSYSPAPKRRGGEYSPSPERRGPRSPNGGPMEREIDDGRTRSRSYSPGYDAANGHDVDRRSSYKAEGGRAARSPSGSRSRSPPPRT

Flanking Sequence Download

Sequence orientation and download details

Upstream/downstream are capped at 10000 bp per side. Negative-strand genes are reverse-complemented so the final FASTA follows transcriptional 5′→3′ orientation.

ID Mapping

Input ID	`TkA02G569930`
TK1151 ID	TkA02G569930
OH-1004 ID	LXL04_012365
Relationship / confidence	Multi Source To Oh1004 / Complex relationship
Protein identity (%)	98.400
Protein coverage (%)	TK1151 100.000 / OH-1004 100.000 Coverage and evidence Coverage is the aligned span of the best-scoring HSP divided by representative protein length. A homolog match does not establish functional validation.
Source version	TK1151 / GWHBCHF00000000

Open Full ID Mapping

SNP / Indel variants and carrier samplesCRA009020 · TK1151

Expand to load variant records for this gene.

Basic Information and Functional Annotation

Gene ID TkA02G569930

Location Chr02:147224890-147227554 (-)

Description Similar to SCL30: Serine/arginine-rich SC35-like splicing factor SCL30

Arabidopsis / Rice Reference Genes and Papers

Download references for this gene

Arabidopsis

Reference gene ID	Possible function	Papers / DOI
`At3g55460`	Involved in intron recognition and spliceosome assembly (Probable).	No verified direct reference in this release
`At3g13570`	Involved in intron recognition and spliceosome assembly.	Identification of an intronic splicing regulatory element involved in auto-regulation of alternative splicing of SCL33 pre-mRNA.2012 · DOI: 10.1111/tpj.12004
`At1g55310`	Involved in intron recognition and spliceosome assembly.	No verified direct reference in this release
`At5g18810`	Involved in intron recognition and spliceosome assembly (Probable).	No verified direct reference in this release

Rice

No hit for this species in the current source table.

Functional annotation source

View annotation sources

Functional annotation source: OH1004 · LXL04_012365 · GCA_047496595.1_OSU_TarKok_2.0. These OH1004 annotations are retrieved through ID mapping; the Arabidopsis/rice table below uses protein alignments from the query reference.

GO annotations (OH1004 source)

GO:0000244 spliceosomal tri-snRNP complex assembly Biological Process

GO:0000381 regulation of alternative mRNA splicing, via spliceosome Biological Process

GO:0000395 mRNA 5'-splice site recognition Biological Process

GO:0000398 mRNA splicing, via spliceosome Biological Process

GO:0008380 RNA splicing Biological Process

GO:0048025 negative regulation of mRNA splicing, via spliceosome Biological Process

GO:0005634 nucleus Cellular Component

GO:0005654 nucleoplasm Cellular Component

GO:0005681 spliceosomal complex Cellular Component

GO:0005730 nucleolus Cellular Component

GO:0005737 cytoplasm Cellular Component

GO:0005829 cytosol Cellular Component

KEGG gene cross-reference

ath:AT1G55310

ath:AT3G13570

ath:AT3G55460

ath:AT5G18810

hsa:135295

These KEGG gene identifiers are linked through homologous proteins; they do not establish pathway function for this gene.

Open Annotation Module

Gene expression

View expression in different studies, tissues and treatments. Results are presented separately by study and measurement unit.

View expression for this gene

Data sources and gene correspondence

Expression data come from public transcriptome studies. Reference genomes, sample metadata and measurement units are shown with the results. Ambiguous cross-reference correspondences do not select an expression record automatically; missing values do not mean zero expression.

Subcellular Localization Top 5

Computational predictions or homology annotations below do not replace localization experiments.

Nucleus0.978

Rank 1 · TkA02G569930 · TK1151

Cytoplasm0.145

Rank 2 · TkA02G569930 · TK1151

Cell membrane0.015

Rank 3 · TkA02G569930 · TK1151

Mitochondrion0.008

Rank 4 · TkA02G569930 · TK1151

Endoplasmic reticulum0.008

Rank 5 · TkA02G569930 · TK1151

LocPro · Direct prediction · Computational prediction, not experimental localization

Open Subcellular Module

Predicted Functional Domains

Domain results are from Pfam-A/HMMER; positions are amino-acid coordinates on the protein sequence.

PF00076RRM_143-112 aa

PF26250RRM_RdRP1_243-98 aa

PF13893RRM_582-119 aa

PF16842RRM_occluded85-115 aa

Gene ID	Domain ID	Domain Name	Start aa	End aa	E-value	Score
TkA02G569930	`PF00076`	RRM_1	43	112	1.3e-16	60.9
TkA02G569930	`PF26250`	RRM_RdRP1_2	43	98	0.04	15.1
TkA02G569930	`PF13893`	RRM_5	82	119	0.16	12.4
TkA02G569930	`PF16842`	RRM_occluded	85	115	0.021	15.4

Arabidopsis / Rice Protein Homology

Only Arabidopsis and rice are shown. Swiss-Prot entries are reviewed; TrEMBL entries are supplementary sequence candidates. Similarity is not experimental validation.

Download current result

Protein	Organism	Description	Identity	Database	Confidence
`Q8L3X8`	Arabidopsis thaliana	sp\|Q8L3X8\|SRC30_ARATH Serine/arginine-rich SC35-like splicing factor SCL30	67.800%	Swiss-Prot	High
`Q9LHP2`	Arabidopsis thaliana	sp\|Q9LHP2\|SL30A_ARATH Serine/arginine-rich SC35-like splicing factor SCL30A	59.300%	Swiss-Prot	Low
`Q9SEU4`	Arabidopsis thaliana	sp\|Q9SEU4\|SRC33_ARATH Serine/arginine-rich SC35-like splicing factor SCL33	50.800%	Swiss-Prot	Medium
`Q1PDV2`	Arabidopsis thaliana	sp\|Q1PDV2\|SRC28_ARATH Serine/arginine-rich SC35-like splicing factor SCL28	54.300%	Swiss-Prot	Low

JBrowse

View in Genome Browser

Gene Card