TkA02G569010 | RubberDandelionOmics

Gene overview

TkA02G569010

Reference: TK1151 Chr: Chr02 Coordinates: 146962118-146970990 Strand: + Type: protein_coding

cDNA / CDS / Protein Sequences

Available sequence downloads CDS FASTA Protein FASTA cDNA FASTA

cDNA

2034 bp · TkA02G569010|TK1151|cDNA

TTACACTTGTGTCTAAAGCATATCTACGACTTCAGTTATGGAACTGTCAAACTTGTACAAAATATGATTTTTATGTTTTATATTGTCCAAAAATCTTGATGAATAAGTTTTGTATTTCCACCATTGTTACCAAAATCTTCAATCATACTACCAAGTAGGCAAGTACACTTCTTTTATGCAATTTCAAATTCAAATAAAGAGTGACCACACGTACCTGCTACAAAAACAAGAAAGACCTCTTTTTGGTAGGGTCTCATCTC...

CDS

Download CDS FASTA

1407 bp · TkA02G569010|TK1151|CDS

ATGGCATCTCTTCGTCTGCTTCTGTTCTTCATTTTTTGTCTATTTTTTCCATCAAGATACTCACTTATTACGTCAAAAAACGCGATCTTACCCCTCAGAATTCAATCAATTTCATCTACCATCTTCATAAAACCACCGAAGAAGCTTCCTTTTCAACACAATGTTACTCTGACAGTCACCCTCGCCGTCGGCTCACCGCCGCAACCGGTTACCATGGTCCTCGACACCGGCAGCGAGCTCTCATGGTTTCACTGTAAAAA...

Protein

Download Protein FASTA

468 aa · TkA02G569010|TK1151|PROTEIN

MASLRLLLFFIFCLFFPSRYSLITSKNAILPLRIQSISSTIFIKPPKKLPFQHNVTLTVTLAVGSPPQPVTMVLDTGSELSWFHCKKTPTTPLSYDPLRSTSYTPVPCSSPICMTRTRDFTVPASCDPKKLCHATLSYADATSVDGNLAYDTFRFPDSDLPGVIFGCMDMESSSNQDEDSKSTGLMGMNRGSLSFVTQIGFPKFSYCISGQESTGVLLFGEYNISSVPPLSYTPMVKMSRPLPYYDRVAYTVQLEGIKVA...

Flanking Sequence Download

Sequence orientation and download details

Upstream/downstream are capped at 10000 bp per side. Negative-strand genes are reverse-complemented so the final FASTA follows transcriptional 5′→3′ orientation.

ID Mapping

Input ID	`TkA02G569010`
TK1151 ID	TkA02G569010
OH-1004 ID	LXL04_014068
Relationship / confidence	Multi Source To Oh1004 / Complex relationship
Protein identity (%)	35.000
Protein coverage (%)	TK1151 86.325 / OH-1004 90.115 Coverage and evidence Coverage is the aligned span of the best-scoring HSP divided by representative protein length. A homolog match does not establish functional validation.
Source version	TK1151 / GWHBCHF00000000

Open Full ID Mapping

SNP / Indel variants and carrier samplesCRA009020 · TK1151

Expand to load variant records for this gene.

Basic Information and Functional Annotation

Gene ID TkA02G569010

Location Chr02:146962118-146970990 (+)

Description Similar to PCS1: Aspartic proteinase PCS1

Arabidopsis / Rice Reference Genes and Papers

Download references for this gene

Arabidopsis

Reference gene ID	Possible function	Papers / DOI
`At5g02190`	Embryo-specific aspartic protease that limits programmed cell death during reproductive development.	No verified direct reference in this release
`At5g10770`	Probably not redundant with AED1 and not involved in restriction of salicylic acid (SA) or systemic acquired resistance (SAR) signaling.	No verified direct reference in this release
`At5g10760`	Aspartyl protease involved in a homeostatic feedback mechanism regulating systemic immunity.	Contrasting Roles of the Apoplastic Aspartyl Protease APOPLASTIC, ENHANCED DISEASE SUSCEPTIBILITY1-DEPENDENT1 and LEGUME LECTIN-LIKE PROTEIN1 in Arabidopsis Systemic Acquired Resistance.2014 · DOI: 10.1104/pp.114.239665

Rice

No hit for this species in the current source table.

Functional annotation source

View annotation sources

Functional annotation source: OH1004 · LXL04_014068 · GCA_047496595.1_OSU_TarKok_2.0. These OH1004 annotations are retrieved through ID mapping; the Arabidopsis/rice table below uses protein alignments from the query reference.

GO annotations (OH1004 source)

GO:0005975 carbohydrate metabolic process Biological Process

GO:0006508 proteolysis Biological Process

GO:0007623 circadian rhythm Biological Process

GO:0009744 response to sucrose Biological Process

GO:0010019 chloroplast-nucleus signaling pathway Biological Process

GO:0012501 programmed cell death Biological Process

GO:0043067 regulation of programmed cell death Biological Process

GO:0005576 extracellular region Cellular Component

GO:0005634 nucleus Cellular Component

GO:0005783 endoplasmic reticulum Cellular Component

GO:0009507 chloroplast Cellular Component

GO:0004190 aspartic-type endopeptidase activity Molecular Function

KEGG gene cross-reference

ath:AT3G12700

ath:AT5G02190

dosa:Os03g0186900

These KEGG gene identifiers are linked through homologous proteins; they do not establish pathway function for this gene.

Open Annotation Module

Gene expression

View expression in different studies, tissues and treatments. Results are presented separately by study and measurement unit.

View expression for this gene

Data sources and gene correspondence

Expression data come from public transcriptome studies. Reference genomes, sample metadata and measurement units are shown with the results. Ambiguous cross-reference correspondences do not select an expression record automatically; missing values do not mean zero expression.

Subcellular Localization Top 5

Computational predictions or homology annotations below do not replace localization experiments.

Extracellular0.379

Rank 1 · TkA02G569010 · TK1151

Cell membrane0.231

Rank 2 · TkA02G569010 · TK1151

Endoplasmic reticulum0.129

Rank 3 · TkA02G569010 · TK1151

Cytoplasm0.089

Rank 4 · TkA02G569010 · TK1151

Lysosome / Vacuole0.085

Rank 5 · TkA02G569010 · TK1151

LocPro · Direct prediction · Computational prediction, not experimental localization

Open Subcellular Module

Predicted Functional Domains

Domain results are from Pfam-A/HMMER; positions are amino-acid coordinates on the protein sequence.

PF14543TAXi_N58-220 aa

PF00026Asp60-416 aa

PF14541TAXi_C249-415 aa

Gene ID	Domain ID	Domain Name	Start aa	End aa	E-value	Score
TkA02G569010	`PF14543`	TAXi_N	58	220	4.7e-38	131.8
TkA02G569010	`PF00026`	Asp	60	416	9.5e-17	62.1
TkA02G569010	`PF14541`	TAXi_C	249	415	1.4e-32	113.4

Arabidopsis / Rice Protein Homology

Only Arabidopsis and rice are shown. Swiss-Prot entries are reviewed; TrEMBL entries are supplementary sequence candidates. Similarity is not experimental validation.

Download current result

Protein	Organism	Description	Identity	Database	Confidence
`Q9LZL3`	Arabidopsis thaliana	sp\|Q9LZL3\|PCS1L_ARATH Aspartic proteinase PCS1	62.500%	Swiss-Prot	High
`Q8S9J6`	Arabidopsis thaliana	sp\|Q8S9J6\|ASPA_ARATH Aspartyl protease family protein At5g10770	30.500%	Swiss-Prot	Medium
`Q9LEW3`	Arabidopsis thaliana	sp\|Q9LEW3\|AED1_ARATH Aspartyl protease AED1	28.600%	Swiss-Prot	Low

JBrowse

View in Genome Browser

Gene Card