Gene Card
Gene overview
cDNA / CDS / Protein Sequences
2963 bp · TkA02G558360|TK1151|cDNA
TTGTTGTTTTATTTGATAAAACTCCATATTAGTGTTTACAAAAGACATATTGTACAATGTTATAATAAAGTACCAACCATATAAAAATAAATCATTTTATTATTACTTAACGCCTAACTTTAAAACCATTATTGATAAGTACCAACCATTTAAAAATATTGAAACTTTGAAAAACTACAAGACCACTTTTGTAATTTTCTCTTAGTTTAAATTTTACGGATATGACATAAAGATGATAGGAGATGATATGGTATAAGATA...
2400 bp · TkA02G558360|TK1151|CDS
ATGCGTGTATGTATGTGTAAATGCCGTGTTTTCTACAACTTAGATTTGTATTGTAAGTCGGCGTTAGTTTCGTGGAATGCAATGCAATTTCGTGGATTTGATCTGAAACGAGAAGCCTTGCTGAAAATTTGTGAACCTCGCTGTGTTTCCAGAGGAATCATGAGCAACGAAGAAGAGAAGAGGTGTCCTTTGTGTGCAGAAGAAATGGACTGGACTGATCAACAGTTGAAGCCCTGCGAATGTGGTTATGAGGTGTGTGT...
Protein
Download Protein FASTA799 aa · TkA02G558360|TK1151|PROTEIN
MRVCMCKCRVFYNLDLYCKSALVSWNAMQFRGFDLKREALLKICEPRCVSRGIMSNEEEKRCPLCAEEMDWTDQQLKPCECGYEVCVWCWHHIMDMAEKDATEGRCPACRTPYDKDRIVEANFQRVSANSSSRKQKQPKAKQKPNEPKKDLSNVRVIQRKMAYIIGLPLSIADEDLLQRKDYFGQYGKVTKVSLSRTAGGTVQQFVNDTCSVYITYSKEEEAVRCIQSVHGYMLDGRFLRASFGTAKYCHAWLRNMPCNN...
Flanking Sequence Download
Sequence orientation and download details
Upstream/downstream are capped at 10000 bp per side. Negative-strand genes are reverse-complemented so the final FASTA follows transcriptional 5′→3′ orientation.
ID Mapping
| Input ID | TkA02G558360 |
|---|---|
| TK1151 ID | TkA02G558360 |
| OH-1004 ID | LXL04_000480 |
| Relationship / confidence | Multi Source To Oh1004 / Complex relationship |
| Protein identity (%) | 38.700 |
| Protein coverage (%) | TK1151 78.974 / OH-1004 86.951Coverage and evidenceCoverage is the aligned span of the best-scoring HSP divided by representative protein length. A homolog match does not establish functional validation. |
| Source version | TK1151 / GWHBCHF00000000 |
SNP / Indel variants and carrier samplesCRA009020 · TK1151
Expand to load variant records for this gene.
Basic Information and Functional Annotation
| Gene ID | TkA02G558360 |
|---|---|
| Location | Chr02:144254801-144259208 (-) |
| Description | Similar to Cnot4: CCR4-NOT transcription complex subunit 4 |
| Arabidopsis / Rice Reference Genes and Papers |
Download references for this gene ArabidopsisNo hit for this species in the current source table. RiceNo hit for this species in the current source table. |
| Functional annotation source | View annotation sourcesFunctional annotation source: OH1004 · |
| GO annotations (OH1004 source) | GO:0000209 protein polyubiquitination Biological Process GO:0000289 nuclear-transcribed mRNA poly(A) tail shortening Biological Process GO:0006351 DNA-templated transcription Biological Process GO:0006511 ubiquitin-dependent protein catabolic process Biological Process GO:0006513 protein monoubiquitination Biological Process GO:0010498 proteasomal protein catabolic process Biological Process GO:0016567 protein ubiquitination Biological Process GO:0031047 regulatory ncRNA-mediated gene silencing Biological Process GO:0031087 deadenylation-independent decapping of nuclear-transcribed mRNA Biological Process GO:0032968 positive regulation of transcription elongation by RNA polymerase II Biological Process GO:0051865 protein autoubiquitination Biological Process GO:0070966 nuclear-transcribed mRNA catabolic process, no-go decay Biological Process |
| KEGG gene cross-reference | hsa:4850 mmu:53621 sce:YER068W spo:2542325 These KEGG gene identifiers are linked through homologous proteins; they do not establish pathway function for this gene. |
Gene expression
View expression in different studies, tissues and treatments. Results are presented separately by study and measurement unit.
Data sources and gene correspondence
Expression data come from public transcriptome studies. Reference genomes, sample metadata and measurement units are shown with the results. Ambiguous cross-reference correspondences do not select an expression record automatically; missing values do not mean zero expression.
Subcellular Localization Top 5
Computational predictions or homology annotations below do not replace localization experiments.
LocPro · Direct prediction · Computational prediction, not experimental localization
Predicted Functional Domains
Domain results are from Pfam-A/HMMER; positions are amino-acid coordinates on the protein sequence.
PF05290Baculo_IE-154-117 aaPF04423Rad50_zn_hook56-70 aaPF14569zf-UDP56-116 aaPF04641Rtf261-150 aaPF14570zf-RING_462-114 aaPF23888DUF724091-130 aaPF04423Rad50_zn_hook101-116 aaPF00076RRM_1163-240 aa| Gene ID | Domain ID | Domain Name | Start aa | End aa | E-value | Score |
|---|---|---|---|---|---|---|
| TkA02G558360 | PF05290 | Baculo_IE-1 | 54 | 117 | 0.0012 | 19.5 |
| TkA02G558360 | PF04423 | Rad50_zn_hook | 56 | 70 | 0.071 | 13.7 |
| TkA02G558360 | PF14569 | zf-UDP | 56 | 116 | 0.081 | 13.7 |
| TkA02G558360 | PF04641 | Rtf2 | 61 | 150 | 0.3 | 11.1 |
| TkA02G558360 | PF14570 | zf-RING_4 | 62 | 114 | 3e-19 | 69.3 |
| TkA02G558360 | PF23888 | DUF7240 | 91 | 130 | 0.028 | 15.4 |
| TkA02G558360 | PF04423 | Rad50_zn_hook | 101 | 116 | 0.071 | 13.7 |
| TkA02G558360 | PF00076 | RRM_1 | 163 | 240 | 3.3e-06 | 27.6 |
| TkA02G558360 | PF05290 | Baculo_IE-1 | 201 | 223 | 0.0012 | 19.5 |
| TkA02G558360 | PF23191 | WHD_MCM3_C | 273 | 284 | 0.25 | 12.3 |
| TkA02G558360 | PF03220 | Tombus_P19 | 421 | 491 | 0.1 | 13.1 |
| TkA02G558360 | PF23191 | WHD_MCM3_C | 494 | 520 | 0.25 | 12.3 |
| TkA02G558360 | PF23888 | DUF7240 | 574 | 617 | 0.028 | 15.4 |
| TkA02G558360 | PF10614 | CsgF | 681 | 742 | 0.26 | 12.1 |
Arabidopsis / Rice Protein Homology
Only Arabidopsis and rice are shown. Swiss-Prot entries are reviewed; TrEMBL entries are supplementary sequence candidates. Similarity is not experimental validation.
No result was found for this query.