TkA02G546060 | RubberDandelionOmics

Gene overview

TkA02G546060

Reference: TK1151 Chr: Chr02 Coordinates: 140848120-140850813 Strand: - Type: protein_coding

cDNA / CDS / Protein Sequences

Available sequence downloads CDS FASTA Protein FASTA cDNA FASTA

cDNA

1853 bp · TkA02G546060|TK1151|cDNA

GTAGCTCTAAAGTCTAATAGTTCATGAACATATTTTATCAAAAAAAGAAGCTTTAAATACAAATTATGATACATCCAAATTATTGTGTGTGGTGAGGTATTTACCATATTTTACATCCTATTGCTTGGTCGTATGTCCTTTCGTGACAATATCTTTTCTACTGTTCCTATTCCAAAGTCCTTTCAGGAGGTCAAACATCGTTCTCTTTTCCTCCTATATATCATCATCATTCATCAATCTTCTTTCATCTTTCAATTCCC...

CDS

Download CDS FASTA

1080 bp · TkA02G546060|TK1151|CDS

ATGAAGTTGCCTTTCCCCTGTTCACAATGTTTCTGCTCCACTTCAGACGACAAAGAGGTCCATAGCACCGATAAAGGTGGAGAAAGTCCTTCGAATTTTAGGTTATTTTCTTACCATGAGTTAAAAGTTGCTAGTAATGGTTTCAGTTCCAGGAATAAAATTGGGGAGGGAGGATTTGGCTCTGTTTACAAGGGTAGACTCACAGACAATACTATTGTGGCAATAAAAGTGCTCTCCGTAGAACTTGAATCCATGAGAGG...

Protein

Download Protein FASTA

359 aa · TkA02G546060|TK1151|PROTEIN

MKLPFPCSQCFCSTSDDKEVHSTDKGGESPSNFRLFSYHELKVASNGFSSRNKIGEGGFGSVYKGRLTDNTIVAIKVLSVELESMRGEREFISEIAALSDVHHENLVNLHGCCVEGAKRCLVYDYMENNSVSHRFLGGEKNRNSFCWSKRKNVALGVAKALAYLHEEKTPYIVHRDIKASNVLLDHNFNPKVADFGLSRLFRDDATHISTRVAGTLGYLSPEYAISGRLTRKSDIYSFGVLLLEIITGRPVVDFDMDRGE...

Flanking Sequence Download

Sequence orientation and download details

Upstream/downstream are capped at 10000 bp per side. Negative-strand genes are reverse-complemented so the final FASTA follows transcriptional 5′→3′ orientation.

ID Mapping

Input ID	`TkA02G546060`
TK1151 ID	TkA02G546060
OH-1004 ID	LXL04_037723
Relationship / confidence	Non Reciprocal Best Hit / Complex relationship
Protein identity (%)	52.000
Protein coverage (%)	TK1151 90.529 / OH-1004 82.902 Coverage and evidence Coverage is the aligned span of the best-scoring HSP divided by representative protein length. A homolog match does not establish functional validation.
Source version	TK1151 / GWHBCHF00000000

Open Full ID Mapping

SNP / Indel variants and carrier samplesCRA009020 · TK1151

Expand to load variant records for this gene.

Basic Information and Functional Annotation

Gene ID TkA02G546060

Location Chr02:140848120-140850813 (-)

Description Similar to CRPK1: Cold-responsive protein kinase 1

Arabidopsis / Rice Reference Genes and Papers

Download references for this gene

Arabidopsis

Reference gene ID	Possible function	Papers / DOI
`At1g16670`	Negative regulator of freezing tolerance that phosphorylates 14-3-3 proteins (e.g. GRF6) thus triggering their translocation from the cytosol to the nucleus in response to cold stress.	No verified direct reference in this release
`At1g56130`	Probable LRR receptor-like serine/threonine-protein kinase At1g56130.	No verified direct reference in this release
`At1g56140`	Probable LRR receptor-like serine/threonine-protein kinase At1g56140.	No verified direct reference in this release
`At1g53420`	Probable LRR receptor-like serine/threonine-protein kinase At1g53420.	No verified direct reference in this release
`At1g70530`	Cysteine-rich receptor-like protein kinase 3.	No verified direct reference in this release

Rice

No hit for this species in the current source table.

Functional annotation source

View annotation sources

Functional annotation source: OH1004 · LXL04_037723 · GCA_047496595.1_OSU_TarKok_2.0. These OH1004 annotations are retrieved through ID mapping; the Arabidopsis/rice table below uses protein alignments from the query reference.

GO annotations (OH1004 source)

GO:0002237 response to molecule of bacterial origin Biological Process

GO:0009409 response to cold Biological Process

GO:0009625 response to insect Biological Process

GO:0045088 regulation of innate immune response Biological Process

GO:0046777 protein autophosphorylation Biological Process

GO:0050826 response to freezing Biological Process

GO:0052542 defense response by callose deposition Biological Process

GO:0005576 extracellular region Cellular Component

GO:0005634 nucleus Cellular Component

GO:0005739 mitochondrion Cellular Component

GO:0005886 plasma membrane Cellular Component

GO:0009507 chloroplast Cellular Component

KEGG gene cross-reference

ath:AT1G16670

ath:AT1G29720

ath:AT1G56130

ath:AT1G56140

ath:AT1G70530

These KEGG gene identifiers are linked through homologous proteins; they do not establish pathway function for this gene.

Open Annotation Module

Gene expression

View expression in different studies, tissues and treatments. Results are presented separately by study and measurement unit.

View expression for this gene

Data sources and gene correspondence

Expression data come from public transcriptome studies. Reference genomes, sample metadata and measurement units are shown with the results. Ambiguous cross-reference correspondences do not select an expression record automatically; missing values do not mean zero expression.

Subcellular Localization Top 5

Computational predictions or homology annotations below do not replace localization experiments.

Cell membrane0.639

Rank 1 · TkA02G546060 · TK1151

Cytoplasm0.275

Rank 2 · TkA02G546060 · TK1151

Nucleus0.207

Rank 3 · TkA02G546060 · TK1151

Endoplasmic reticulum0.046

Rank 4 · TkA02G546060 · TK1151

Golgi apparatus0.035

Rank 5 · TkA02G546060 · TK1151

LocPro · Direct prediction · Computational prediction, not experimental localization

Open Subcellular Module

Predicted Functional Domains

Domain results are from Pfam-A/HMMER; positions are amino-acid coordinates on the protein sequence.

PF00069Pkinase49-259 aa

PF07714PK_Tyr_Ser-Thr51-322 aa

PF03109ABC154-83 aa

PF12330Haspin_kinase141-206 aa

PF01636APH160-198 aa

PF03109ABC1162-204 aa

PF11916Vac14_Fig4_bd260-319 aa

PF03109ABC1268-305 aa

Gene ID	Domain ID	Domain Name	Start aa	End aa	E-value	Score
TkA02G546060	`PF00069`	Pkinase	49	259	1.2e-46	160.0
TkA02G546060	`PF07714`	PK_Tyr_Ser-Thr	51	322	7.6e-46	157.2
TkA02G546060	`PF03109`	ABC1	54	83	0.00036	20.5
TkA02G546060	`PF12330`	Haspin_kinase	141	206	0.0064	16.3
TkA02G546060	`PF01636`	APH	160	198	0.21	12.0
TkA02G546060	`PF03109`	ABC1	162	204	0.00036	20.5
TkA02G546060	`PF11916`	Vac14_Fig4_bd	260	319	0.13	12.5
TkA02G546060	`PF03109`	ABC1	268	305	0.00036	20.5

Arabidopsis / Rice Protein Homology

Only Arabidopsis and rice are shown. Swiss-Prot entries are reviewed; TrEMBL entries are supplementary sequence candidates. Similarity is not experimental validation.

Download current result

Protein	Organism	Description	Identity	Database	Confidence
`Q93YN1`	Arabidopsis thaliana	sp\|Q93YN1\|CRPK1_ARATH Cold-responsive protein kinase 1	48.600%	Swiss-Prot	Medium
`C0LGH2`	Arabidopsis thaliana	sp\|C0LGH2\|Y1561_ARATH Probable LRR receptor-like serine/threonine-protein kinase At1g56130	47.400%	Swiss-Prot	Medium
`C0LGH3`	Arabidopsis thaliana	sp\|C0LGH3\|Y5614_ARATH Probable LRR receptor-like serine/threonine-protein kinase At1g56140	47.700%	Swiss-Prot	Medium
`C0LGG7`	Arabidopsis thaliana	sp\|C0LGG7\|Y1534_ARATH Probable LRR receptor-like serine/threonine-protein kinase At1g53420	48.500%	Swiss-Prot	Medium
`Q9CAL2`	Arabidopsis thaliana	sp\|Q9CAL2\|CRK3_ARATH Cysteine-rich receptor-like protein kinase 3	45.500%	Swiss-Prot	Medium

JBrowse

View in Genome Browser

Gene Card