TkA02G521980 | RubberDandelionOmics

Gene overview

TkA02G521980

Reference: TK1151 Chr: Chr02 Coordinates: 134620859-134625334 Strand: + Type: protein_coding

cDNA / CDS / Protein Sequences

Available sequence downloads CDS FASTA Protein FASTA cDNA FASTA

cDNA

3354 bp · TkA02G521980|TK1151|cDNA

TTTTAATTTTTTTTTTTACATCTGGAGAGCTAAGTAAAAGAAAGCTTTATACTTTATACATGGACTCTCGCTTCAAGAAAATTGGAGATAAATTTTATAAGGATTTTTTTTTGCTAGGTTGGAAAAAAGTGTTAGAAGTTAAAAAAAGACATAAACCCACATTGGCTTTTTCTGCCTTTTGTTTCGACTTTTGTTTCTGTGCTACCTATGCATTTGTCTATGTCTGCCTTCCTTCTTCTGCTTACCCTCCCCTCTTTTAA...

CDS

Download CDS FASTA

2355 bp · TkA02G521980|TK1151|CDS

ATGGAGATTGATCTGAATCATGCAGTGAGTGGTCAAAATGCTGAATCTTACGGAAATGGAGGGGGCTCATCACTGTCGACTTCATCAAACTCCTCGAATTCCTCCTTAAAGTCCCCGAATTCCGACCCTTCGTCTTCGGTTTACATGGAACTTTGGCATGCTTGTGCTGGCCCTCTTACAACTCTCCCAAGTAAAGGAAATGTGGTCGTTTATTTCCCTCAAGGCCACTTGGAGCAAATTGCCTCTCACTCATCCACACA...

Protein

Download Protein FASTA

784 aa · TkA02G521980|TK1151|PROTEIN

MEIDLNHAVSGQNAESYGNGGGSSLSTSSNSSNSSLKSPNSDPSSSVYMELWHACAGPLTTLPSKGNVVVYFPQGHLEQIASHSSTHFSPIEVPSLGLPPQIFCKIVDVQLLANKDNDEVFTKLALLPLPEGDLREDEEDGGGVTPTRSTPQMFCKTLTASDTSTHGGFSVPRRAAEDCFPPLDYKQQRPSQELVAKDLHGVEWKFRHIYRGQPRRHLLTTGWSIFVSQKNLVSGDAVLFLRGGGELRLGIRRATRPKNI...

Flanking Sequence Download

Sequence orientation and download details

Upstream/downstream are capped at 10000 bp per side. Negative-strand genes are reverse-complemented so the final FASTA follows transcriptional 5′→3′ orientation.

ID Mapping

Input ID	`TkA02G521980`
TK1151 ID	TkA02G521980
OH-1004 ID	LXL04_004461
Relationship / confidence	Multi Source To Oh1004 / Complex relationship
Protein identity (%)	66.800
Protein coverage (%)	TK1151 99.235 / OH-1004 99.735 Coverage and evidence Coverage is the aligned span of the best-scoring HSP divided by representative protein length. A homolog match does not establish functional validation.
Source version	TK1151 / GWHBCHF00000000

Open Full ID Mapping

SNP / Indel variants and carrier samplesCRA009020 · TK1151

Expand to load variant records for this gene.

Basic Information and Functional Annotation

Gene ID TkA02G521980

Location Chr02:134620859-134625334 (+)

Description Similar to ARF4: Auxin response factor 4

Arabidopsis / Rice Reference Genes and Papers

Download references for this gene

Arabidopsis

Reference gene ID	Possible function	Papers / DOI
`At5g60450`	Auxin response factors (ARFs) are transcriptional factors that bind specifically to the DNA sequence 5'-TGTCTC-3' found in the auxin-responsive promoter elements (AuxREs).	No verified direct reference in this release
`At5g62000`	Auxin response factors (ARFs) are transcriptional factors that bind specifically to the DNA sequence 5'-TGTCTC-3' found in the auxin-responsive promoter elements (AuxREs).	AUXIN RESPONSE FACTOR 2 (ARF2): a pleiotropic developmental regulator.2005 · DOI: 10.1111/j.1365-313x.2005.02426.x AUXIN RESPONSE FACTOR1 and AUXIN RESPONSE FACTOR2 regulate senescence and floral organ abscission in Arabidopsis thaliana.2005 · DOI: 10.1242/dev.02012 The AUXIN RESPONSE FACTOR 2 gene of Arabidopsis links auxin signalling, cell division, and the size of seeds and other organs.2006 · DOI: 10.1242/dev.02194

Rice

Reference gene ID	Possible function	Papers / DOI
`Os02g0557200`	Auxin response factors (ARFs) are transcriptional factors that bind specifically to the DNA sequence 5'-TGTCTC-3' found in the auxin-responsive promoter elements (AuxREs).	No verified direct reference in this release

Functional annotation source

View annotation sources

Functional annotation source: OH1004 · LXL04_004461 · GCA_047496595.1_OSU_TarKok_2.0. These OH1004 annotations are retrieved through ID mapping; the Arabidopsis/rice table below uses protein alignments from the query reference.

GO annotations (OH1004 source)

GO:0006351 DNA-templated transcription Biological Process

GO:0006355 regulation of DNA-templated transcription Biological Process

GO:0009733 response to auxin Biological Process

GO:0009734 auxin-activated signaling pathway Biological Process

GO:0009850 auxin metabolic process Biological Process

GO:0010050 vegetative phase change Biological Process

GO:0010158 abaxial cell fate specification Biological Process

GO:0010582 floral meristem determinacy Biological Process

GO:1902584 positive regulation of response to water deprivation Biological Process

GO:0005634 nucleus Cellular Component

GO:0000976 transcription cis-regulatory region binding Molecular Function

GO:0003677 DNA binding Molecular Function

KEGG gene cross-reference

ath:AT2G33860

ath:AT5G60450

dosa:Os01g0670800

dosa:Os01g0753500

dosa:Os05g0563400

These KEGG gene identifiers are linked through homologous proteins; they do not establish pathway function for this gene.

Open Annotation Module

Gene expression

View expression in different studies, tissues and treatments. Results are presented separately by study and measurement unit.

View expression for this gene

Data sources and gene correspondence

Expression data come from public transcriptome studies. Reference genomes, sample metadata and measurement units are shown with the results. Ambiguous cross-reference correspondences do not select an expression record automatically; missing values do not mean zero expression.

Subcellular Localization Top 5

Computational predictions or homology annotations below do not replace localization experiments.

Nucleus0.975

Rank 1 · TkA02G521980 · TK1151

Cytoplasm0.080

Rank 2 · TkA02G521980 · TK1151

Cell membrane0.025

Rank 3 · TkA02G521980 · TK1151

Endoplasmic reticulum0.014

Rank 4 · TkA02G521980 · TK1151

Plastid0.013

Rank 5 · TkA02G521980 · TK1151

LocPro · Direct prediction · Computational prediction, not experimental localization

Open Subcellular Module

Predicted Functional Domains

Domain results are from Pfam-A/HMMER; positions are amino-acid coordinates on the protein sequence.

PF07655Secretin_N_29-75 aa

PF25313BRWD_AD62-115 aa

PF02362B3154-254 aa

PF25313BRWD_AD281-382 aa

PF06507ARF_AD302-383 aa

PF07655Secretin_N_2610-636 aa

PF02309AUX_IAA651-701 aa

PF00564PB1676-725 aa

Gene ID	Domain ID	Domain Name	Start aa	End aa	E-value	Score
TkA02G521980	`PF07655`	Secretin_N_2	9	75	5.3	8.4
TkA02G521980	`PF25313`	BRWD_AD	62	115	4.9e-10	40.4
TkA02G521980	`PF02362`	B3	154	254	5.1e-23	81.6
TkA02G521980	`PF25313`	BRWD_AD	281	382	4.9e-10	40.4
TkA02G521980	`PF06507`	ARF_AD	302	383	1.2e-32	112.3
TkA02G521980	`PF07655`	Secretin_N_2	610	636	5.3	8.4
TkA02G521980	`PF02309`	AUX_IAA	651	701	2e-09	38.3
TkA02G521980	`PF00564`	PB1	676	725	0.093	13.4
TkA02G521980	`PF02362`	B3	712	735	5.1e-23	81.6
TkA02G521980	`PF02309`	AUX_IAA	712	748	2e-09	38.3

Arabidopsis / Rice Protein Homology

Only Arabidopsis and rice are shown. Swiss-Prot entries are reviewed; TrEMBL entries are supplementary sequence candidates. Similarity is not experimental validation.

Download current result

Protein	Organism	Description	Identity	Database	Confidence
`Q9ZTX9`	Arabidopsis thaliana	sp\|Q9ZTX9\|ARFD_ARATH Auxin response factor 4	54.100%	Swiss-Prot	High
`Q94JM3`	Arabidopsis thaliana	sp\|Q94JM3\|ARFB_ARATH Auxin response factor 2	36.300%	Swiss-Prot	Medium
`Q6YVY0`	Oryza sativa subsp. japonica	sp\|Q6YVY0\|ARFG_ORYSJ Auxin response factor 7	38.200%	Swiss-Prot	Medium

JBrowse

View in Genome Browser

Gene Card