TkA02G513550 | RubberDandelionOmics

Gene overview

TkA02G513550

Reference: TK1151 Chr: Chr02 Coordinates: 131859880-131863262 Strand: - Type: protein_coding

cDNA / CDS / Protein Sequences

Available sequence downloads CDS FASTA Protein FASTA cDNA FASTA

cDNA

2008 bp · TkA02G513550|TK1151|cDNA

CAGAAACGAAACGTTTGCGGCTGCGTAATGATCAATGCTTTCCTCCATGAAAACAGGAATCCAAGCAAATGCACCGGAAAAGATCTTTCCTGCTACTTTTCTATCTCGTAACTATGTTTCCGTGATTGTTCTCACTATGCCATTGCCATAAACCCTTTCTTCAAAAACCCTCTGTTTTGAGTTGCATTTCTGTAAAGATCTGGCGATCATATGGCGATTCATTGATTACTCGTCGCACACGAAGTTTGAAAGGCGTAATC...

CDS

Download CDS FASTA

1449 bp · TkA02G513550|TK1151|CDS

ATGGCAACTTCTCAAAAATCTTCAAAGGCACCTGAACCAAGAGCTCCAAATCCAAATGCTCCGAAAATTTCAAAGGCTTTTAGTGCCATGAAGTTGTTAGGCTTTTCCCCTGAAGTTGTGAAACCAGTCCTCAAAAATCTTCATGAATTGTATGATGGAAACTGGGAACTAATTGAAGAAGACAACTATCAAACTCTTGCAGATGCTATTTTGGAATCCTTTGACGACAAGAAGAAGAGTAAAGCTGTCATGGTGAAAGA...

Protein

Download Protein FASTA

482 aa · TkA02G513550|TK1151|PROTEIN

MATSQKSSKAPEPRAPNPNAPKISKAFSAMKLLGFSPEVVKPVLKNLHELYDGNWELIEEDNYQTLADAILESFDDKKKSKAVMVKETHSLSSEDQSSSASENGNRNTNSNSNRNVEGSSGIQKKRHQNNESHEDKKLFHKIKDITKGTEKIKISLIDEIGIDLPKFGYIPQNTTYQDAYVPFTLARIADENCCIKCNGDCLSSRVPCACSRETGGEFAYTPQGLLKQDFLKSCISMYHEPQDHHFFNCQDCPLERVKNM...

Flanking Sequence Download

Sequence orientation and download details

Upstream/downstream are capped at 10000 bp per side. Negative-strand genes are reverse-complemented so the final FASTA follows transcriptional 5′→3′ orientation.

ID Mapping

Input ID	`TkA02G513550`
TK1151 ID	TkA02G513550
OH-1004 ID	LXL04_013176
Relationship / confidence	Rbh Sequence Supported / Probable
Protein identity (%)	94.800
Protein coverage (%)	TK1151 100.000 / OH-1004 98.973 Coverage and evidence Coverage is the aligned span of the best-scoring HSP divided by representative protein length. A homolog match does not establish functional validation.
Source version	TK1151 / GWHBCHF00000000

Open Full ID Mapping

SNP / Indel variants and carrier samplesCRA009020 · TK1151

Expand to load variant records for this gene.

Basic Information and Functional Annotation

Gene ID TkA02G513550

Location Chr02:131859880-131863262 (-)

Description Similar to SUVR4: Histone-lysine N-methyltransferase SUVR4

Arabidopsis / Rice Reference Genes and Papers

Download references for this gene

Arabidopsis

Reference gene ID	Possible function	Papers / DOI
`At3g04380`	Histone methyltransferase that converts monomethylated 'Lys-9' of histone H3 (H3K9me1) to dimethylated 'Lys-9' (H3K9me2) in the absence of bound ubiquitin, and to trimethylated 'Lys-9' (H3K9me3) in the presence of bound ubiquitin.	The SUVR4 histone lysine methyltransferase binds ubiquitin and converts H3K9me1 to H3K9me3 on transposon chromatin in Arabidopsis.2011 · DOI: 10.1371/journal.pgen.1001325
`At5g43990`	Probable inactive histone-lysine methyltransferase that acts as regulator of transcriptional gene silencing independently of histone H3K9 methylation.	SUVR2 is involved in transcriptional gene silencing by associating with SNF2-related chromatin-remodeling proteins in Arabidopsis.2014 · DOI: 10.1038/cr.2014.156
`At1g04050`	Probable inactive histone-lysine methyltransferase that acts as regulator of transcriptional gene silencing independently of histone H3K9 methylation.	No verified direct reference in this release

Rice

No hit for this species in the current source table.

Functional annotation source

View annotation sources

Functional annotation source: OH1004 · LXL04_013176 · GCA_047496595.1_OSU_TarKok_2.0. These OH1004 annotations are retrieved through ID mapping; the Arabidopsis/rice table below uses protein alignments from the query reference.

GO annotations (OH1004 source)

GO:0006338 chromatin remodeling Biological Process

GO:0031047 regulatory ncRNA-mediated gene silencing Biological Process

GO:0032259 methylation Biological Process

GO:0080188 gene silencing by siRNA-directed DNA methylation Biological Process

GO:0005634 nucleus Cellular Component

GO:0005694 chromosome Cellular Component

GO:0005730 nucleolus Cellular Component

GO:0009506 plasmodesma Cellular Component

GO:0009507 chloroplast Cellular Component

GO:0008270 zinc ion binding Molecular Function

GO:0042054 histone methyltransferase activity Molecular Function

GO:0042802 identical protein binding Molecular Function

KEGG gene cross-reference

ath:AT1G04050

ath:AT3G04380

ath:AT5G43990

These KEGG gene identifiers are linked through homologous proteins; they do not establish pathway function for this gene.

Open Annotation Module

Gene expression

View expression in different studies, tissues and treatments. Results are presented separately by study and measurement unit.

View expression for this gene

Data sources and gene correspondence

Expression data come from public transcriptome studies. Reference genomes, sample metadata and measurement units are shown with the results. Ambiguous cross-reference correspondences do not select an expression record automatically; missing values do not mean zero expression.

Subcellular Localization Top 5

Computational predictions or homology annotations below do not replace localization experiments.

Nucleus0.905

Rank 1 · TkA02G513550 · TK1151

Cytoplasm0.142

Rank 2 · TkA02G513550 · TK1151

Cell membrane0.034

Rank 3 · TkA02G513550 · TK1151

Mitochondrion0.019

Rank 4 · TkA02G513550 · TK1151

Endoplasmic reticulum0.017

Rank 5 · TkA02G513550 · TK1151

LocPro · Direct prediction · Computational prediction, not experimental localization

Open Subcellular Module

Predicted Functional Domains

Domain results are from Pfam-A/HMMER; positions are amino-acid coordinates on the protein sequence.

PF10440WIYLD21-75 aa

PF17308Corazonin84-135 aa

PF00856SET93-150 aa

PF05033Pre-SET147-291 aa

PF00856SET310-432 aa

PF05033Pre-SET444-455 aa

Gene ID	Domain ID	Domain Name	Start aa	End aa	E-value	Score
TkA02G513550	`PF10440`	WIYLD	21	75	1e-19	70.8
TkA02G513550	`PF17308`	Corazonin	84	135	0.66	11.1
TkA02G513550	`PF00856`	SET	93	150	3.2e-20	73.2
TkA02G513550	`PF05033`	Pre-SET	147	291	2.4e-11	44.8
TkA02G513550	`PF00856`	SET	310	432	3.2e-20	73.2
TkA02G513550	`PF05033`	Pre-SET	444	455	2.4e-11	44.8

Arabidopsis / Rice Protein Homology

Only Arabidopsis and rice are shown. Swiss-Prot entries are reviewed; TrEMBL entries are supplementary sequence candidates. Similarity is not experimental validation.

Download current result

Protein	Organism	Description	Identity	Database	Confidence
`Q8W595`	Arabidopsis thaliana	sp\|Q8W595\|SUVR4_ARATH Histone-lysine N-methyltransferase SUVR4	54.400%	Swiss-Prot	High
`Q9FNC7`	Arabidopsis thaliana	sp\|Q9FNC7\|SUVR2_ARATH Probable inactive histone-lysine N-methyltransferase SUVR2	53.400%	Swiss-Prot	Medium
`Q946J2`	Arabidopsis thaliana	sp\|Q946J2\|SUVR1_ARATH Probable inactive histone-lysine N-methyltransferase SUVR1	53.400%	Swiss-Prot	Medium

JBrowse

View in Genome Browser

Gene Card