TkA02G510800 | RubberDandelionOmics

Gene overview

TkA02G510800

Reference: TK1151 Chr: Chr02 Coordinates: 131143199-131144203 Strand: - Type: protein_coding

cDNA / CDS / Protein Sequences

Available sequence downloads CDS FASTA Protein FASTA cDNA FASTA

cDNA

975 bp · TkA02G510800|TK1151|cDNA

ATGGAAAGCTTCACGGTGGAGGAGCTGACTGCAGCCACCGGAGATTTCTGCTCCAGCAACCTTATTGAAGGAAGCGTCTATCACGGCCGCCTGAATGGAAAAAACTTGGCGATCAAGCGCACAGACCAGAATACTATCTCCAAGATCAATTTTAATCTGTTTCACGACGCTACACATTTTCAGCCCAATGTGGTTAGGTTTTTGGGGAGCTGTACGGCGGACGCCGGAGGCGGGTTTTTGGTGTTTGAGTACGCGAAAAA...

CDS

Download CDS FASTA

975 bp · TkA02G510800|TK1151|CDS

ATGGAAAGCTTCACGGTGGAGGAGCTGACTGCAGCCACCGGAGATTTCTGCTCCAGCAACCTTATTGAAGGAAGCGTCTATCACGGCCGCCTGAATGGAAAAAACTTGGCGATCAAGCGCACAGACCAGAATACTATCTCCAAGATCAATTTTAATCTGTTTCACGACGCTACACATTTTCAGCCCAATGTGGTTAGGTTTTTGGGGAGCTGTACGGCGGACGCCGGAGGCGGGTTTTTGGTGTTTGAGTACGCGAAAAA...

Protein

Download Protein FASTA

324 aa · TkA02G510800|TK1151|PROTEIN

MESFTVEELTAATGDFCSSNLIEGSVYHGRLNGKNLAIKRTDQNTISKINFNLFHDATHFQPNVVRFLGSCTADAGGGFLVFEYAKNGSLKDWIHGGLAMKSHFIASCDCFLTWNQRVRICLDVATGLQYLHLIMNPSYIHKNIKSRNIFLDDEFKAKIGNFGMEEVESNSSSSLWDRGYIAPEVLLSSGEIDRRIDIYAFGVVLLEIISGKPPVISKDKSENEEQGVLLSEKFKCVIRSSNDYAELREWMDNALGENYS...

Flanking Sequence Download

Sequence orientation and download details

Upstream/downstream are capped at 10000 bp per side. Negative-strand genes are reverse-complemented so the final FASTA follows transcriptional 5′→3′ orientation.

ID Mapping

Input ID	`TkA02G510800`
TK1151 ID	TkA02G510800
OH-1004 ID	LXL04_023837
Relationship / confidence	Multi Source To Oh1004 / Complex relationship
Protein identity (%)	58.000
Protein coverage (%)	TK1151 98.765 / OH-1004 73.719 Coverage and evidence Coverage is the aligned span of the best-scoring HSP divided by representative protein length. A homolog match does not establish functional validation.
Source version	TK1151 / GWHBCHF00000000

Open Full ID Mapping

SNP / Indel variants and carrier samplesCRA009020 · TK1151

Expand to load variant records for this gene.

Basic Information and Functional Annotation

Gene ID TkA02G510800

Location Chr02:131143199-131144203 (-)

Description Similar to LYK2: Protein LYK2

Arabidopsis / Rice Reference Genes and Papers

Download references for this gene

Arabidopsis

Reference gene ID	Possible function	Papers / DOI
`At3g01840`	May recognize microbe-derived N-acetylglucosamine (NAG)-containing ligands.	No verified direct reference in this release
`At2g33580`	May recognize microbe-derived N-acetylglucosamine (NAG)-containing ligands.	No verified direct reference in this release
`At3g21630`	Lysin motif (LysM) receptor kinase that functions as a cell surface receptor in chitin elicitor (chitooligosaccharides) signaling leading to innate immunity toward both biotic and abiotic stresses (e.g. tolerance to salinity, heavy-metal stresses, and Botrytis cinerea infection).	CERK1, a LysM receptor kinase, is essential for chitin elicitor signaling in Arabidopsis.2007 · DOI: 10.1073/pnas.0705147104 AvrPtoB targets the LysM receptor kinase CERK1 to promote bacterial virulence on plants.2009 · DOI: 10.1016/j.cub.2009.01.054 The lysin motif receptor-like kinase (LysM-RLK) CERK1 is a major chitin-binding protein in Arabidopsis thaliana and subject to chitin-induced phosphorylation.2010 · DOI: 10.1074/jbc.m110.116657 Arabidopsis lysin-motif proteins LYM1 LYM3 CERK1 mediate bacterial peptidoglycan sensing and immunity to bacterial infection.2011 · DOI: 10.1073/pnas.1112862108 The LysM receptor-like kinase LysM RLK1 is required to activate defense and abiotic-stress responses induced by overexpression of fungal chitinases in Arabidopsis plants.2012 · DOI: 10.1093/mp/sss021 Functional characterization of CEBiP and CERK1 homologs in arabidopsis and rice reveals the presence of different chitin receptor systems in plants.2012 · DOI: 10.1093/pcp/pcs113 Selective regulation of the chitin-induced defense response by the Arabidopsis receptor-like cytoplasmic kinase PBL27.2014 · DOI: 10.1111/tpj.12535

Rice

No hit for this species in the current source table.

Functional annotation source

View annotation sources

Functional annotation source: OH1004 · LXL04_023837 · GCA_047496595.1_OSU_TarKok_2.0. These OH1004 annotations are retrieved through ID mapping; the Arabidopsis/rice table below uses protein alignments from the query reference.

GO annotations (OH1004 source)

GO:0002758 innate immune response-activating signaling pathway Biological Process

GO:0006952 defense response Biological Process

GO:0007165 signal transduction Biological Process

GO:0009737 response to abscisic acid Biological Process

GO:0009738 abscisic acid-activated signaling pathway Biological Process

GO:0009789 positive regulation of abscisic acid-activated signaling pathway Biological Process

GO:0010089 xylem development Biological Process

GO:0031348 negative regulation of defense response Biological Process

GO:0045087 innate immune response Biological Process

GO:0050832 defense response to fungus Biological Process

GO:0071323 cellular response to chitin Biological Process

GO:0005576 extracellular region Cellular Component

KEGG gene cross-reference

ath:AT1G51940

ath:AT2G28250

ath:AT2G33580

ath:AT3G01840

dosa:Os08g0538300

These KEGG gene identifiers are linked through homologous proteins; they do not establish pathway function for this gene.

Open Annotation Module

Gene expression

View expression in different studies, tissues and treatments. Results are presented separately by study and measurement unit.

View expression for this gene

Data sources and gene correspondence

Expression data come from public transcriptome studies. Reference genomes, sample metadata and measurement units are shown with the results. Ambiguous cross-reference correspondences do not select an expression record automatically; missing values do not mean zero expression.

Subcellular Localization Top 5

Computational predictions or homology annotations below do not replace localization experiments.

Cell membrane0.448

Rank 1 · TkA02G510800 · TK1151

Cytoplasm0.411

Rank 2 · TkA02G510800 · TK1151

Nucleus0.323

Rank 3 · TkA02G510800 · TK1151

Endoplasmic reticulum0.039

Rank 4 · TkA02G510800 · TK1151

Golgi apparatus0.030

Rank 5 · TkA02G510800 · TK1151

LocPro · Direct prediction · Computational prediction, not experimental localization

Open Subcellular Module

Predicted Functional Domains

Domain results are from Pfam-A/HMMER; positions are amino-acid coordinates on the protein sequence.

PF20222DUF65812-63 aa

PF00069Pkinase24-291 aa

PF07714PK_Tyr_Ser-Thr24-291 aa

PF24476DUF758089-240 aa

PF14531Kinase-like139-215 aa

Gene ID	Domain ID	Domain Name	Start aa	End aa	E-value	Score
TkA02G510800	`PF20222`	DUF6581	2	63	0.33	10.5
TkA02G510800	`PF00069`	Pkinase	24	291	2e-28	100.2
TkA02G510800	`PF07714`	PK_Tyr_Ser-Thr	24	291	9.2e-28	98.0
TkA02G510800	`PF24476`	DUF7580	89	240	0.096	13.0
TkA02G510800	`PF14531`	Kinase-like	139	215	0.23	11.4

Arabidopsis / Rice Protein Homology

Only Arabidopsis and rice are shown. Swiss-Prot entries are reviewed; TrEMBL entries are supplementary sequence candidates. Similarity is not experimental validation.

Download current result

Protein	Organism	Description	Identity	Database	Confidence
`Q9SGI7`	Arabidopsis thaliana	sp\|Q9SGI7\|LYK2_ARATH Protein LYK2	42.000%	Swiss-Prot	Medium
`O22808`	Arabidopsis thaliana	sp\|O22808\|LYK5_ARATH Protein LYK5	37.100%	Swiss-Prot	Medium
`A8R7E6`	Arabidopsis thaliana	sp\|A8R7E6\|CERK1_ARATH Chitin elicitor receptor kinase 1	35.800%	Swiss-Prot	Medium

JBrowse

View in Genome Browser

Gene Card