TkA02G509830 | RubberDandelionOmics

Gene overview

TkA02G509830

Reference: TK1151 Chr: Chr02 Coordinates: 130849411-130854456 Strand: - Type: protein_coding

cDNA / CDS / Protein Sequences

Available sequence downloads CDS FASTA Protein FASTA cDNA FASTA

cDNA

2607 bp · TkA02G509830|TK1151|cDNA

GGACCTGATTTGTAAAAATACATAACTAAATCTTCATAAGCAAAACTCAAATCGAGAGAGAGAAAGAAGAGAGAGATGAGAACCAAGCTGTAGGGAGAGAGGGAGATTATATGTACAGAGAGAGGAAGCGCATGGTTGATGACGATGGACCGAGAAAAGGAAAGAGAGACGGAGCTAGAGAGTGCGATGTATACCAACTGTTTGTTGTTAGGGCTTGATCCGTCGATCATCGGAGTCGGAGCAAATAACGGTACTCCTCG...

CDS

Download CDS FASTA

2064 bp · TkA02G509830|TK1151|CDS

ATGACGATGGACCGAGAAAAGGAAAGAGAGACGGAGCTAGAGAGTGCGATGTATACCAACTGTTTGTTGTTAGGGCTTGATCCGTCGATCATCGGAGTCGGAGCAAATAACGGTACTCCTCGGGTGGGGTCATTTCGACACTCCAACCCTAAATTGGGTGAACAGCTACTATACTTCATATTGTCCTCTCTCAGAGGTCCAAAAGATTTTGATAAAGTGTGGCCGATTTTTGATTCTACTCAATCTCGCGATTTTCGCAA...

Protein

Download Protein FASTA

687 aa · TkA02G509830|TK1151|PROTEIN

MTMDREKERETELESAMYTNCLLLGLDPSIIGVGANNGTPRVGSFRHSNPKLGEQLLYFILSSLRGPKDFDKVWPIFDSTQSRDFRKVVQSIISELESQGALPRSNSRVSSLATCCGPRFVELLWQLSLHALREVHRRTYAADVVSNPLPASLTDVAFSHAATLLPVTKARIALERRRFLKNAETAVQRQAMWSNLAHEMTAEYRGLCAEEAYLQQELEKLHDLRNKVKMEGEPWDELVSSSSQNSHLVQRATRLWDSLL...

Flanking Sequence Download

Sequence orientation and download details

Upstream/downstream are capped at 10000 bp per side. Negative-strand genes are reverse-complemented so the final FASTA follows transcriptional 5′→3′ orientation.

ID Mapping

Input ID	`TkA02G509830`
TK1151 ID	TkA02G509830
OH-1004 ID	LXL04_013239
Relationship / confidence	Rbh Sequence Supported / Probable
Protein identity (%)	94.800
Protein coverage (%)	TK1151 100.000 / OH-1004 100.000 Coverage and evidence Coverage is the aligned span of the best-scoring HSP divided by representative protein length. A homolog match does not establish functional validation.
Source version	TK1151 / GWHBCHF00000000

Open Full ID Mapping

SNP / Indel variants and carrier samplesCRA009020 · TK1151

Expand to load variant records for this gene.

Basic Information and Functional Annotation

Gene ID TkA02G509830

Location Chr02:130849411-130854456 (-)

Description Similar to AUG6: AUGMIN subunit 6

Arabidopsis / Rice Reference Genes and Papers

Download references for this gene

Arabidopsis

Reference gene ID	Possible function	Papers / DOI
`At5g40740`	Contributes to the assembly of the acentrosomal spindle and phragmoplast microtubule arrays as part of the augmin complex.	Characterization of the Arabidopsis augmin complex uncovers its critical function in the assembly of the acentrosomal spindle and phragmoplast microtubule arrays.2012 · DOI: 10.1105/tpc.112.096610

Rice

No hit for this species in the current source table.

Functional annotation source

View annotation sources

Functional annotation source: OH1004 · LXL04_013239 · GCA_047496595.1_OSU_TarKok_2.0. These OH1004 annotations are retrieved through ID mapping; the Arabidopsis/rice table below uses protein alignments from the query reference.

GO annotations (OH1004 source)

GO:0000226 microtubule cytoskeleton organization Biological Process

GO:0009561 megagametogenesis Biological Process

GO:0051225 spindle assembly Biological Process

GO:0051301 cell division Biological Process

GO:0055046 microgametogenesis Biological Process

GO:0005634 nucleus Cellular Component

GO:0005819 spindle Cellular Component

GO:0009524 phragmoplast Cellular Component

GO:0070652 HAUS complex Cellular Component

GO:1990498 mitotic spindle microtubule Cellular Component

GO:0008017 microtubule binding Molecular Function

GO:0051011 microtubule minus-end binding Molecular Function

KEGG gene cross-reference

ath:AT5G40740

These KEGG gene identifiers are linked through homologous proteins; they do not establish pathway function for this gene.

Open Annotation Module

Gene expression

View expression in different studies, tissues and treatments. Results are presented separately by study and measurement unit.

View expression for this gene

Data sources and gene correspondence

Expression data come from public transcriptome studies. Reference genomes, sample metadata and measurement units are shown with the results. Ambiguous cross-reference correspondences do not select an expression record automatically; missing values do not mean zero expression.

Subcellular Localization Top 5

Computational predictions or homology annotations below do not replace localization experiments.

Cytoplasm0.683

Rank 1 · TkA02G509830 · TK1151

Nucleus0.209

Rank 2 · TkA02G509830 · TK1151

Golgi apparatus0.136

Rank 3 · TkA02G509830 · TK1151

Cell membrane0.110

Rank 4 · TkA02G509830 · TK1151

Endoplasmic reticulum0.062

Rank 5 · TkA02G509830 · TK1151

LocPro · Direct prediction · Computational prediction, not experimental localization

Open Subcellular Module

Predicted Functional Domains

Domain results are from Pfam-A/HMMER; positions are amino-acid coordinates on the protein sequence.

PF14661HAUS6_N17-256 aa

PF13094CENP-Q74-98 aa

PF03666NPR3184-259 aa

PF19443DAHL191-227 aa

PF09789CC149206-277 aa

PF13094CENP-Q209-264 aa

PF15112DUF4559212-229 aa

PF08654DASH_Dad2216-262 aa

Gene ID	Domain ID	Domain Name	Start aa	End aa	E-value	Score
TkA02G509830	`PF14661`	HAUS6_N	17	256	6.9e-40	137.8
TkA02G509830	`PF13094`	CENP-Q	74	98	0.3	11.9
TkA02G509830	`PF03666`	NPR3	184	259	0.00047	19.8
TkA02G509830	`PF19443`	DAHL	191	227	0.011	16.1
TkA02G509830	`PF09789`	CC149	206	277	0.073	13.1
TkA02G509830	`PF13094`	CENP-Q	209	264	0.3	11.9
TkA02G509830	`PF15112`	DUF4559	212	229	5.2	7.2
TkA02G509830	`PF08654`	DASH_Dad2	216	262	0.0025	18.9
TkA02G509830	`PF30469`	CIP7_N	257	280	0.21	12.6
TkA02G509830	`PF21746`	DUF6869	263	283	0.18	12.4
TkA02G509830	`PF15112`	DUF4559	333	354	5.2	7.2
TkA02G509830	`PF08654`	DASH_Dad2	334	363	0.0025	18.9
TkA02G509830	`PF13094`	CENP-Q	350	416	0.3	11.9
TkA02G509830	`PF19443`	DAHL	373	440	0.011	16.1
TkA02G509830	`PF14661`	HAUS6_N	378	429	6.9e-40	137.8
TkA02G509830	`PF15112`	DUF4559	380	477	5.2	7.2

Arabidopsis / Rice Protein Homology

Only Arabidopsis and rice are shown. Swiss-Prot entries are reviewed; TrEMBL entries are supplementary sequence candidates. Similarity is not experimental validation.

Download current result

Protein	Organism	Description	Identity	Database	Confidence
`Q94BP7`	Arabidopsis thaliana	sp\|Q94BP7\|AUG6_ARATH AUGMIN subunit 6	64.300%	Swiss-Prot	High

JBrowse

View in Genome Browser

Gene Card