TkA02G501940 | RubberDandelionOmics

Gene overview

TkA02G501940

Reference: TK1151 Chr: Chr02 Coordinates: 128631510-128632187 Strand: - Type: protein_coding

cDNA / CDS / Protein Sequences

Available sequence downloads CDS FASTA Protein FASTA cDNA FASTA

cDNA

640 bp · TkA02G501940|TK1151|cDNA

ATTGTACCTTTTGAGACGTATTTTCAAAATTGAACGCGTTCTTGGGCTTTCCCTTTTACAGAATCTTCTGAAATACCGCACCATGCGATGGCTAACTCTGTCTCTTGGTCGGCAGTCCACCTTTCAGTAGCTGCTTTGCCTTTTCCCTTTTTTGTTGTTGTTGTGTTTCCTCTTCGGGGTCCGATTCTGAGACATATTCGTTGTCGGAATCAATCTCTTGGAATGGGTCTTGAGAGTGAGTTTGAGGTGGAGTTTAAGAT...

CDS

Download CDS FASTA

375 bp · TkA02G501940|TK1151|CDS

ATGGCTAACTCTGTCTCTTGGTCGGCAGTCCACCTTTCAGTAGCTGCTTTGCCTTTTCCCTTTTTTGTTGTTGTTGTGTTTCCTCTTCGGGGTCCGATTCTGAGACATATTCGTTGTCGGAATCAATCTCTTGGAATGGGTCTTGAGAGTGAGTTTGAGGTGGAGTTTAAGATGGATATTCCGAGACAAATTGGTGTTGGGAGTAATGTTGGGATGATTAAGAGTGTTGTTGGGAATAATGGGATGATTGAGATGATGGA...

Protein

Download Protein FASTA

124 aa · TkA02G501940|TK1151|PROTEIN

MANSVSWSAVHLSVAALPFPFFVVVVFPLRGPILRHIRCRNQSLGMGLESEFEVEFKMDIPRQIGVGSNVGMIKSVVGNNGMIEMMEKVCRRVGIVVGSNAFVEMIAFAFVEAGVVVDLLVRKG

Flanking Sequence Download

Sequence orientation and download details

Upstream/downstream are capped at 10000 bp per side. Negative-strand genes are reverse-complemented so the final FASTA follows transcriptional 5′→3′ orientation.

ID Mapping

Input ID	`TkA02G501940`
TK1151 ID	TkA02G501940
OH-1004 ID	LXL04_035081
Relationship / confidence	Multi Source To Oh1004 / Complex relationship
Protein identity (%)	51.900
Protein coverage (%)	TK1151 84.677 / OH-1004 21.381 Coverage and evidence Coverage is the aligned span of the best-scoring HSP divided by representative protein length. A homolog match does not establish functional validation.
Source version	TK1151 / GWHBCHF00000000

Open Full ID Mapping

SNP / Indel variants and carrier samplesCRA009020 · TK1151

Expand to load variant records for this gene.

Basic Information and Functional Annotation

Gene ID	`TkA02G501940`
Location	Chr02:128631510-128632187 (-)
Description	Similar to 60S acidic ribosomal protein P0
Arabidopsis / Rice Reference Genes and Papers	Download references for this gene Arabidopsis No hit for this species in the current source table. Rice No hit for this species in the current source table.
Functional annotation source	View annotation sources Functional annotation source: OH1004 · `LXL04_035081` · GCA_047496595.1_OSU_TarKok_2.0. These OH1004 annotations are retrieved through ID mapping; the Arabidopsis/rice table below uses protein alignments from the query reference.
GO annotations (OH1004 source)	GO:0002181 cytoplasmic translation Biological Process GO:0010043 response to zinc ion Biological Process GO:0042254 ribosome biogenesis Biological Process GO:0042742 defense response to bacterium Biological Process GO:0046686 response to cadmium ion Biological Process GO:0005634 nucleus Cellular Component GO:0005730 nucleolus Cellular Component GO:0005737 cytoplasm Cellular Component GO:0005794 Golgi apparatus Cellular Component GO:0005829 cytosol Cellular Component GO:0009506 plasmodesma Cellular Component GO:0022625 cytosolic large ribosomal subunit Cellular Component
KEGG gene cross-reference	ath:AT2G40010 ath:AT3G09200 ath:AT3G11250 dosa:Os08g0130500 gmx:547816 osa:4344590 These KEGG gene identifiers are linked through homologous proteins; they do not establish pathway function for this gene.

Open Annotation Module

Gene expression

View expression in different studies, tissues and treatments. Results are presented separately by study and measurement unit.

View expression for this gene

Data sources and gene correspondence

Expression data come from public transcriptome studies. Reference genomes, sample metadata and measurement units are shown with the results. Ambiguous cross-reference correspondences do not select an expression record automatically; missing values do not mean zero expression.

Subcellular Localization Top 5

Computational predictions or homology annotations below do not replace localization experiments.

Cytoplasm0.382

Rank 1 · TkA02G501940 · TK1151

Nucleus0.298

Rank 2 · TkA02G501940 · TK1151

Mitochondrion0.152

Rank 3 · TkA02G501940 · TK1151

Cell membrane0.136

Rank 4 · TkA02G501940 · TK1151

Plastid0.084

Rank 5 · TkA02G501940 · TK1151

LocPro · Direct prediction · Computational prediction, not experimental localization

Open Subcellular Module

Predicted Functional Domains

Domain results are from Pfam-A/HMMER; positions are amino-acid coordinates on the protein sequence.

PF17626IncF8-25 aa

PF17626IncF72-110 aa

Gene ID	Domain ID	Domain Name	Start aa	End aa	E-value	Score
TkA02G501940	`PF17626`	IncF	8	25	0.13	13.3
TkA02G501940	`PF17626`	IncF	72	110	0.13	13.3

Arabidopsis / Rice Protein Homology

Only Arabidopsis and rice are shown. Swiss-Prot entries are reviewed; TrEMBL entries are supplementary sequence candidates. Similarity is not experimental validation.

Download current result

No result was found for this query.

JBrowse

View in Genome Browser

Gene Card