RubberDandelionOmics Rubber Dandelion Multi-omics Website
More
Transcriptome Expression Annotation Rubber Pathway TF Prediction Targets Protein Network Resequencing Tools Downloads
ZH EN

How to use this page

Gene Card

Enter a TK1151 or OH-1004 gene ID to view sequences, annotations and analyses in the corresponding reference genome.
Flanking length, max 10000 bp
Examples TkA01G624900 LXL04_000258

Gene overview

TkA02G489970
Reference: TK1151 Chr: Chr02 Coordinates: 125275353-125279337 Strand: + Type: protein_coding

cDNA / CDS / Protein Sequences

Available sequence downloads CDS FASTA Protein FASTA cDNA FASTA

cDNA

Download cDNA FASTA

2248 bp · TkA02G489970|TK1151|cDNA

TTCTCTTCAGTGCCCTGCGCATTGAATGAATTCGATATCCTTTCTGCAATTTGTTGCAGATTGGAGCTACTCGCTGGTTACCCGACATCGCCGATGGAGATGCCGTCACCAAATGTCCATCCTACCCCCTCCACCGCTGCCGGCAGATCGGAGTCGCCAGATGATTCCACGATTTTACAGGTCATTGACTCGGTGAAGAAGAAAGTTGATGCTGATCGTTGTGTTTATATAATGAAAAGAATGAAAGAGAACCAGATTAA...

CDS

Download CDS FASTA

2160 bp · TkA02G489970|TK1151|CDS

TTCTCTTCAGTGCCCTGCGCATTGAATGAATTCGATATCCTTTCTGCAATTTGTTGCAGATTGGAGCTACTCGCTGGTTACCCGACATCGCCGATGGAGATGCCGTCACCAAATGTCCATCCTACCCCCTCCACCGCTGCCGGCAGATCGGAGTCGCCAGATGATTCCACGATTTTACAGGTCATTGACTCGGTGAAGAAGAAAGTTGATGCTGATCGTTGTGTTTATATAATGAAAAGAATGAAAGAGAACCAGATTAA...

Protein

Download Protein FASTA

719 aa · TkA02G489970|TK1151|PROTEIN

FSSVPCALNEFDILSAICCRLELLAGYPTSPMEMPSPNVHPTPSTAAGRSESPDDSTILQVIDSVKKKVDADRCVYIMKRMKENQIKLAETTKNHHRLSAERRNLTTKNGDNIINSLERRQKDAIDMQVGAAISSQGDGYVSVVLLGSGIPVKSSVRPVNLPEVEKIPPYTTWVFMDRNRRMTEDQSVVGRRRIYYDRNGGEALICSDSEEEVIDDEENKKEFADSEDTIIRMTIEQLGSSDVVLDSLAKYLSRKPCEVK...

Flanking Sequence Download

Sequence orientation and download details

Upstream/downstream are capped at 10000 bp per side. Negative-strand genes are reverse-complemented so the final FASTA follows transcriptional 5′→3′ orientation.

Download Gene (CDS) Download Protein

ID Mapping

Input IDTkA02G489970
TK1151 IDTkA02G489970
OH-1004 IDLXL04_013559
Relationship / confidenceRbh Sequence Supported / Probable
Protein identity (%)92.300
Protein coverage (%)TK1151 98.470 / OH-1004 99.721
Coverage and evidence

Coverage is the aligned span of the best-scoring HSP divided by representative protein length. A homolog match does not establish functional validation.

Source versionTK1151 / GWHBCHF00000000
Open Full ID Mapping
SNP / Indel variants and carrier samplesCRA009020 · TK1151

Expand to load variant records for this gene.

Basic Information and Functional Annotation

Gene IDTkA02G489970
LocationChr02:125275353-125279337 (+)
DescriptionSimilar to EZ1: Histone-lysine N-methyltransferase EZ1
Arabidopsis / Rice Reference Genes and Papers

Download references for this gene

Arabidopsis

Reference gene IDPossible functionPapers / DOI
At2g23380 Polycomb group (PcG) protein.
Genetic analysis of incurvata mutants reveals three independent genetic operations at work in Arabidopsis leaf morphogenesis.2000 · DOI: 10.1093/genetics/156.3.1363
At4g02020 Polycomb group (PcG) protein. No verified direct reference in this release

Rice

Reference gene IDPossible functionPapers / DOI
Os06g0275500 Polycomb group (PcG) protein.
The rice enhancer of zeste [E(z)] genes SDG711 and SDG718 are respectively involved in long day and short day signaling to mediate the accurate photoperiod control of flowering time.2014 · DOI: 10.3389/fpls.2014.00591
Functional annotation source
View annotation sources

Functional annotation source: OH1004 · LXL04_013559 · GCA_047496595.1_OSU_TarKok_2.0. These OH1004 annotations are retrieved through ID mapping; the Arabidopsis/rice table below uses protein alignments from the query reference.

GO annotations (OH1004 source)
GO:0006351 DNA-templated transcription Biological Process
GO:0006355 regulation of DNA-templated transcription Biological Process
GO:0009294 DNA-mediated transformation Biological Process
GO:0009737 response to abscisic acid Biological Process
GO:0009738 abscisic acid-activated signaling pathway Biological Process
GO:0009908 flower development Biological Process
GO:0009909 regulation of flower development Biological Process
GO:0009965 leaf morphogenesis Biological Process
GO:0010048 vernalization response Biological Process
GO:0010228 vegetative to reproductive phase transition of meristem Biological Process
GO:0030154 cell differentiation Biological Process
GO:0031507 heterochromatin formation Biological Process
KEGG gene cross-reference
ath:AT2G23380
dosa:Os06g0275500
osa:4340748
zma:541954
These KEGG gene identifiers are linked through homologous proteins; they do not establish pathway function for this gene.
Open Annotation Module

Gene expression

View expression in different studies, tissues and treatments. Results are presented separately by study and measurement unit.

View expression for this gene
Data sources and gene correspondence

Expression data come from public transcriptome studies. Reference genomes, sample metadata and measurement units are shown with the results. Ambiguous cross-reference correspondences do not select an expression record automatically; missing values do not mean zero expression.

Subcellular Localization Top 5

Computational predictions or homology annotations below do not replace localization experiments.

Nucleus0.923
Rank 1 · TkA02G489970 · TK1151
Cytoplasm0.138
Rank 2 · TkA02G489970 · TK1151
Cell membrane0.026
Rank 3 · TkA02G489970 · TK1151
Mitochondrion0.024
Rank 4 · TkA02G489970 · TK1151
Endoplasmic reticulum0.011
Rank 5 · TkA02G489970 · TK1151

LocPro · Direct prediction · Computational prediction, not experimental localization

Open Subcellular Module

Predicted Functional Domains

Domain results are from Pfam-A/HMMER; positions are amino-acid coordinates on the protein sequence.

PF17535DUF545456-124 aa
PF20824Cmr2_hel_dom258-99 aa
PF00856SET210-352 aa
PF25996HTH_CLF_N223-266 aa
PF03638TCR312-318 aa
PF03638TCR475-506 aa
PF18264preSET_CXC476-496 aa
PF03638TCR510-541 aa
Gene IDDomain IDDomain NameStart aaEnd aaE-valueScore
TkA02G489970PF17535DUF5454561240.06113.5
TkA02G489970PF20824Cmr2_hel_dom258990.1413.3
TkA02G489970PF00856SET2103528.7e-2071.9
TkA02G489970PF25996HTH_CLF_N2232661.5e-1763.6
TkA02G489970PF03638TCR3123180.005517.7
TkA02G489970PF03638TCR4755060.005517.7
TkA02G489970PF18264preSET_CXC4764961.5e-0835.7
TkA02G489970PF03638TCR5105410.005517.7
TkA02G489970PF18264preSET_CXC5115421.5e-0835.7
TkA02G489970PF00856SET5285388.7e-2071.9
TkA02G489970PF00856SET5846878.7e-2071.9
TkA02G489970PF17535DUF54545946510.06113.5

Arabidopsis / Rice Protein Homology

Only Arabidopsis and rice are shown. Swiss-Prot entries are reviewed; TrEMBL entries are supplementary sequence candidates. Similarity is not experimental validation.

Download current result

ProteinOrganismDescriptionIdentityDatabaseConfidence
P93831Arabidopsis thalianasp|P93831|CLF_ARATH Histone-lysine N-methyltransferase CLF46.900%Swiss-ProtMedium
Q9ZSM8Arabidopsis thalianasp|Q9ZSM8|EZA1_ARATH Histone-lysine N-methyltransferase EZA145.200%Swiss-ProtMedium
Q5VN06Oryza sativa subsp. japonicasp|Q5VN06|CLF_ORYSJ Histone-lysine N-methyltransferase CLF45.400%Swiss-ProtMedium

JBrowse

View in Genome Browser