TkA02G478740 | RubberDandelionOmics

Gene overview

TkA02G478740

Reference: TK1151 Chr: Chr02 Coordinates: 122176817-122177240 Strand: + Type: protein_coding

cDNA / CDS / Protein Sequences

Available sequence downloads CDS FASTA Protein FASTA cDNA FASTA

cDNA

327 bp · TkA02G478740|TK1151|cDNA

ATGGGAGATCCAATCGTGTCTTCTGTAGTCAATCAAGTAATGGAAAGATCCACATCTTTAGCAGCCCAAGATTTCGCGGTTTTATGGGGCCTCAAGTCCGATCTCCGGTCTTTACGGACCATTTTTACTCAGATCCAAGCGGTGCTCGCCGACGCTGAAGTCAAACAGAGGAAGAACAAAGCGTTACAGGACTGGCTAAGGAAACTCAGAGCTGCATCTTTCGAGGTCGAGAACGTGTTAGAAGAGGTCTCTACCGAAGC...

CDS

Download CDS FASTA

327 bp · TkA02G478740|TK1151|CDS

ATGGGAGATCCAATCGTGTCTTCTGTAGTCAATCAAGTAATGGAAAGATCCACATCTTTAGCAGCCCAAGATTTCGCGGTTTTATGGGGCCTCAAGTCCGATCTCCGGTCTTTACGGACCATTTTTACTCAGATCCAAGCGGTGCTCGCCGACGCTGAAGTCAAACAGAGGAAGAACAAAGCGTTACAGGACTGGCTAAGGAAACTCAGAGCTGCATCTTTCGAGGTCGAGAACGTGTTAGAAGAGGTCTCTACCGAAGC...

Protein

Download Protein FASTA

108 aa · TkA02G478740|TK1151|PROTEIN

MGDPIVSSVVNQVMERSTSLAAQDFAVLWGLKSDLRSLRTIFTQIQAVLADAEVKQRKNKALQDWLRKLRAASFEVENVLEEVSTEALLRRLHVERGIKNRPRESTLN

Flanking Sequence Download

Sequence orientation and download details

Upstream/downstream are capped at 10000 bp per side. Negative-strand genes are reverse-complemented so the final FASTA follows transcriptional 5′→3′ orientation.

ID Mapping

Input ID	`TkA02G478740`
TK1151 ID	TkA02G478740
OH-1004 ID	LXL04_013681
Relationship / confidence	Sequence Supported Annotation Or Model Conflict / Review
Protein identity (%)	100.000
Protein coverage (%)	TK1151 93.519 / OH-1004 10.171 Coverage and evidence Coverage is the aligned span of the best-scoring HSP divided by representative protein length. A homolog match does not establish functional validation.
Source version	TK1151 / GWHBCHF00000000

Open Full ID Mapping

SNP / Indel variants and carrier samplesCRA009020 · TK1151

Expand to load variant records for this gene.

Basic Information and Functional Annotation

Gene ID TkA02G478740

Location Chr02:122176817-122177240 (+)

Description Similar to RGA2: Disease resistance protein RGA2

Arabidopsis / Rice Reference Genes and Papers

Download references for this gene

Arabidopsis

Reference gene ID	Possible function	Papers / DOI
`At3g14460`	Potential disease resistance protein.	No verified direct reference in this release

Rice

No hit for this species in the current source table.

Functional annotation source

View annotation sources

Functional annotation source: OH1004 · LXL04_013681 · GCA_047496595.1_OSU_TarKok_2.0. These OH1004 annotations are retrieved through ID mapping; the Arabidopsis/rice table below uses protein alignments from the query reference.

GO annotations (OH1004 source)

GO:0051607 defense response to virus Biological Process

GO:0098542 defense response to other organism Biological Process

GO:0005576 extracellular region Cellular Component

GO:0005524 ATP binding Molecular Function

GO:0043531 ADP binding Molecular Function

KEGG gene cross-reference

ath:AT3G14470

These KEGG gene identifiers are linked through homologous proteins; they do not establish pathway function for this gene.

Open Annotation Module

Gene expression

View expression in different studies, tissues and treatments. Results are presented separately by study and measurement unit.

View expression for this gene

Data sources and gene correspondence

Expression data come from public transcriptome studies. Reference genomes, sample metadata and measurement units are shown with the results. Ambiguous cross-reference correspondences do not select an expression record automatically; missing values do not mean zero expression.

Subcellular Localization Top 5

Computational predictions or homology annotations below do not replace localization experiments.

Cell membrane0.297

Rank 1 · TkA02G478740 · TK1151

Cytoplasm0.210

Rank 2 · TkA02G478740 · TK1151

Plastid0.210

Rank 3 · TkA02G478740 · TK1151

Endoplasmic reticulum0.147

Rank 4 · TkA02G478740 · TK1151

Nucleus0.104

Rank 5 · TkA02G478740 · TK1151

LocPro · Direct prediction · Computational prediction, not experimental localization

Open Subcellular Module

Predicted Functional Domains

Domain results are from Pfam-A/HMMER; positions are amino-acid coordinates on the protein sequence.

PF18052Rx_N9-93 aa

PF18595Nuf2_DHR10-like27-82 aa

PF15177IL28A30-92 aa

Gene ID	Domain ID	Domain Name	Start aa	End aa	E-value	Score
TkA02G478740	`PF18052`	Rx_N	9	93	3e-21	76.0
TkA02G478740	`PF18595`	Nuf2_DHR10-like	27	82	0.014	16.1
TkA02G478740	`PF15177`	IL28A	30	92	0.0063	17.1

Arabidopsis / Rice Protein Homology

Only Arabidopsis and rice are shown. Swiss-Prot entries are reviewed; TrEMBL entries are supplementary sequence candidates. Similarity is not experimental validation.

Download current result

Protein	Organism	Description	Identity	Database	Confidence
`Q9LRR5`	Arabidopsis thaliana	sp\|Q9LRR5\|DRL21_ARATH Putative disease resistance protein At3g14460	32.000%	Swiss-Prot	Medium

JBrowse

View in Genome Browser

Gene Card