TkA02G476110 | RubberDandelionOmics

Gene overview

TkA02G476110

Reference: TK1151 Chr: Chr02 Coordinates: 121495953-121506277 Strand: - Type: protein_coding

cDNA / CDS / Protein Sequences

Available sequence downloads CDS FASTA Protein FASTA cDNA FASTA

cDNA

768 bp · TkA02G476110|TK1151|cDNA

AAACTTCATGCAGCAATACTATGCAGTCCCGGCGTCGGTCATTTGGTCCCGGTGATACTACTTGGCCGCCGACTTATCACCCACCACAACCTCCAGGTCACCATCTTCGCCGTCACCACCACCACCTCACCAGCCGAATCCCAACTCCTTACTACCCTCACCGCCGACATCCACCTACCGGTCATCAAAATCCCTGCTGCAGACATATCCTCAGGCGTTTCCCCAGAAGCCAAAGTCGTCACTAAGATCTGCGTCATGAT...

CDS

Download CDS FASTA

768 bp · TkA02G476110|TK1151|CDS

AAACTTCATGCAGCAATACTATGCAGTCCCGGCGTCGGTCATTTGGTCCCGGTGATACTACTTGGCCGCCGACTTATCACCCACCACAACCTCCAGGTCACCATCTTCGCCGTCACCACCACCACCTCACCAGCCGAATCCCAACTCCTTACTACCCTCACCGCCGACATCCACCTACCGGTCATCAAAATCCCTGCTGCAGACATATCCTCAGGCGTTTCCCCAGAAGCCAAAGTCGTCACTAAGATCTGCGTCATGAT...

Protein

Download Protein FASTA

255 aa · TkA02G476110|TK1151|PROTEIN

KLHAAILCSPGVGHLVPVILLGRRLITHHNLQVTIFAVTTTTSPAESQLLTTLTADIHLPVIKIPAADISSGVSPEAKVVTKICVMMRETMPTIRTTISSMEPRPDVIIGDIFSTESWAIAEEFGMAKYVFITGNAWFAGVITYSLVLDKKVEGQYVDQKDPLEIPGCKLVRPEPALDPMLDRDDEDYQVYLNLAVGVTMADGILINTWENLEPQSLHALRSNEILSSIVKNKPVYTVGPITKKYEPVGLKNEVI

Flanking Sequence Download

Sequence orientation and download details

Upstream/downstream are capped at 10000 bp per side. Negative-strand genes are reverse-complemented so the final FASTA follows transcriptional 5′→3′ orientation.

ID Mapping

Input ID	`TkA02G476110`
TK1151 ID	TkA02G476110
OH-1004 ID	LXL04_013723
Relationship / confidence	Multi Source To Oh1004 / Complex relationship
Protein identity (%)	83.500
Protein coverage (%)	TK1151 100.000 / OH-1004 53.236 Coverage and evidence Coverage is the aligned span of the best-scoring HSP divided by representative protein length. A homolog match does not establish functional validation.
Source version	TK1151 / GWHBCHF00000000

Open Full ID Mapping

SNP / Indel variants and carrier samplesCRA009020 · TK1151

Expand to load variant records for this gene.

Basic Information and Functional Annotation

Gene ID TkA02G476110

Location Chr02:121495953-121506277 (-)

Description Similar to GT5: Anthocyanidin 3-O-glucosyltransferase 5

Arabidopsis / Rice Reference Genes and Papers

Download references for this gene

Arabidopsis

Reference gene ID	Possible function	Papers / DOI
`At2g18570`	UDP-glycosyltransferase 72D1.	No verified direct reference in this release
`At5g66690`	Involved in the O-glucosylation of monolignols (alcohol monomers of lignin).	Arabidopsis glucosyltransferases with activities toward both endogenous and xenobiotic substrates.2003 · DOI: 10.1007/s00425-002-0969-0 Identification and characterisation of Arabidopsis glycosyltransferases capable of glucosylating coniferyl aldehyde and sinapyl aldehyde.2005 · DOI: 10.1016/j.febslet.2005.04.016 The glucosyltransferase UGT72E2 is responsible for monolignol 4-O-glucoside production in Arabidopsis thaliana.2006 · DOI: 10.1111/j.1365-313x.2006.02872.x Enzymatic and metabolic engineering for efficient production of syringin, sinapyl alcohol 4-O-glucoside, in Arabidopsis thaliana.2014 · DOI: 10.1016/j.phytochem.2014.03.003
`At5g26310`	Involved in the O-glucosylation of monolignols (alcohol monomers of lignin).	Enzymatic and metabolic engineering for efficient production of syringin, sinapyl alcohol 4-O-glucoside, in Arabidopsis thaliana.2014 · DOI: 10.1016/j.phytochem.2014.03.003
`At3g50740`	UDP-glycosyltransferase that glucosylates coniferyl aldehyde to form coniferyl aldehyde 4-O-glucoside.	Identification and characterisation of Arabidopsis glycosyltransferases capable of glucosylating coniferyl aldehyde and sinapyl aldehyde.2005 · DOI: 10.1016/j.febslet.2005.04.016

Rice

No hit for this species in the current source table.

Functional annotation source

View annotation sources

Functional annotation source: OH1004 · LXL04_013723 · GCA_047496595.1_OSU_TarKok_2.0. These OH1004 annotations are retrieved through ID mapping; the Arabidopsis/rice table below uses protein alignments from the query reference.

GO annotations (OH1004 source)

GO:0009636 response to toxic substance Biological Process

GO:0009718 anthocyanin-containing compound biosynthetic process Biological Process

GO:0009808 lignin metabolic process Biological Process

GO:0005634 nucleus Cellular Component

GO:0009507 chloroplast Cellular Component

GO:0008194 UDP-glycosyltransferase activity Molecular Function

GO:0047209 coniferyl-alcohol glucosyltransferase activity Molecular Function

GO:0047213 anthocyanidin 3-O-glucosyltransferase activity Molecular Function

GO:0047218 hydroxycinnamate 4-beta-glucosyltransferase activity Molecular Function

KEGG gene cross-reference

ath:AT2G18570

ath:AT3G50740

ath:AT5G26310

ath:AT5G66690

These KEGG gene identifiers are linked through homologous proteins; they do not establish pathway function for this gene.

Open Annotation Module

Gene expression

View expression in different studies, tissues and treatments. Results are presented separately by study and measurement unit.

View expression for this gene

Data sources and gene correspondence

Expression data come from public transcriptome studies. Reference genomes, sample metadata and measurement units are shown with the results. Ambiguous cross-reference correspondences do not select an expression record automatically; missing values do not mean zero expression.

Subcellular Localization Top 5

Computational predictions or homology annotations below do not replace localization experiments.

Cytoplasm0.830

Rank 1 · TkA02G476110 · TK1151

Nucleus0.241

Rank 2 · TkA02G476110 · TK1151

Peroxisome0.060

Rank 3 · TkA02G476110 · TK1151

Endoplasmic reticulum0.053

Rank 4 · TkA02G476110 · TK1151

Cell membrane0.039

Rank 5 · TkA02G476110 · TK1151

LocPro · Direct prediction · Computational prediction, not experimental localization

Open Subcellular Module

Predicted Functional Domains

No result was found for this query.

Arabidopsis / Rice Protein Homology

Only Arabidopsis and rice are shown. Swiss-Prot entries are reviewed; TrEMBL entries are supplementary sequence candidates. Similarity is not experimental validation.

Download current result

Protein	Organism	Description	Identity	Database	Confidence
`Q9ZU72`	Arabidopsis thaliana	sp\|Q9ZU72\|U72D1_ARATH UDP-glycosyltransferase 72D1	41.700%	Swiss-Prot	Medium
`Q9LVR1`	Arabidopsis thaliana	sp\|Q9LVR1\|U72E2_ARATH UDP-glycosyltransferase 72E2	41.200%	Swiss-Prot	Medium
`O81498`	Arabidopsis thaliana	sp\|O81498\|U72E3_ARATH UDP-glycosyltransferase 72E3	41.200%	Swiss-Prot	Medium
`Q94A84`	Arabidopsis thaliana	sp\|Q94A84\|U72E1_ARATH UDP-glycosyltransferase 72E1	37.500%	Swiss-Prot	Medium

JBrowse

View in Genome Browser

Gene Card