TkA02G474750 | RubberDandelionOmics

Gene overview

TkA02G474750

Reference: TK1151 Chr: Chr02 Coordinates: 121175875-121178135 Strand: - Type: protein_coding

cDNA / CDS / Protein Sequences

Available sequence downloads CDS FASTA Protein FASTA cDNA FASTA

cDNA

1682 bp · TkA02G474750|TK1151|cDNA

CTTCACCAATTTCGGTTTTGGGGTTTCAAAGCAATTTGCGTTTTCATCTGGTTTTGACGATGGAGGTCAAAGAGGAAGTTCATAGTGATGATGGATCTTACGAATTTGTTAACTTCGATGATTTCTCTAGTAACATGGATCAATCCAGTGATGGTTCTTACGACTTCCTTTCTTCTGATCTGTCAGATATACTTGTTCTTACTGAAGGAGTTTCTAACAACATACCTCTTAATGATGACGATATTTCTGCACAAATCAAA...

CDS

Download CDS FASTA

1428 bp · TkA02G474750|TK1151|CDS

ATGGAGGTCAAAGAGGAAGTTCATAGTGATGATGGATCTTACGAATTTGTTAACTTCGATGATTTCTCTAGTAACATGGATCAATCCAGTGATGGTTCTTACGACTTCCTTTCTTCTGATCTGTCAGATATACTTGTTCTTACTGAAGGAGTTTCTAACAACATACCTCTTAATGATGACGATATTTCTGCACAAATCAAATCGTTTTCACTCAATTCACCAAGTGTGGACTCAGAATACGAAGAATCGGATGAAGAAGA...

Protein

Download Protein FASTA

475 aa · TkA02G474750|TK1151|PROTEIN

MEVKEEVHSDDGSYEFVNFDDFSSNMDQSSDGSYDFLSSDLSDILVLTEGVSNNIPLNDDDISAQIKSFSLNSPSVDSEYEESDEEEEYVDMDFAESEEEMSADMDITANRYNNMGKKRHYFRSYHKLTNKKKIKDVAKTHILCYLPAKSLARCRLVCKEWDSWISTPLFAHTQSHSFTKTSGFFQDNENGLIRFISLDHVSYGVPHPTLNFLPKKVSIKSSSHGLLLCQAINDESEYYACNPANKQFIEIPNSSYHHGK...

Flanking Sequence Download

Sequence orientation and download details

Upstream/downstream are capped at 10000 bp per side. Negative-strand genes are reverse-complemented so the final FASTA follows transcriptional 5′→3′ orientation.

ID Mapping

Input ID	`TkA02G474750`
TK1151 ID	TkA02G474750
OH-1004 ID	LXL04_013734
Relationship / confidence	Sequence Supported Annotation Or Model Conflict / Review
Protein identity (%)	99.400
Protein coverage (%)	TK1151 100.000 / OH-1004 32.827 Coverage and evidence Coverage is the aligned span of the best-scoring HSP divided by representative protein length. A homolog match does not establish functional validation.
Source version	TK1151 / GWHBCHF00000000

Open Full ID Mapping

SNP / Indel variants and carrier samplesCRA009020 · TK1151

Expand to load variant records for this gene.

Basic Information and Functional Annotation

Gene ID TkA02G474750

Location Chr02:121175875-121178135 (-)

Description Similar to At5g07610: F-box protein At5g07610

Arabidopsis / Rice Reference Genes and Papers

Download references for this gene

Arabidopsis

Reference gene ID	Possible function	Papers / DOI
`At2g23160`	F-box protein At2g23160.	No verified direct reference in this release

Rice

No hit for this species in the current source table.

Functional annotation source

View annotation sources

Functional annotation source: OH1004 · LXL04_013734 · GCA_047496595.1_OSU_TarKok_2.0. These OH1004 annotations are retrieved through ID mapping; the Arabidopsis/rice table below uses protein alignments from the query reference.

GO annotations (OH1004 source)

GO:0016567 protein ubiquitination Biological Process

GO:0005634 nucleus Cellular Component

KEGG gene cross-reference

ath:AT5G07610

ath:AT5G49610

These KEGG gene identifiers are linked through homologous proteins; they do not establish pathway function for this gene.

Open Annotation Module

Gene expression

View expression in different studies, tissues and treatments. Results are presented separately by study and measurement unit.

View expression for this gene

Data sources and gene correspondence

Expression data come from public transcriptome studies. Reference genomes, sample metadata and measurement units are shown with the results. Ambiguous cross-reference correspondences do not select an expression record automatically; missing values do not mean zero expression.

Subcellular Localization Top 5

Computational predictions or homology annotations below do not replace localization experiments.

Nucleus0.647

Rank 1 · TkA02G474750 · TK1151

Cytoplasm0.355

Rank 2 · TkA02G474750 · TK1151

Cell membrane0.097

Rank 3 · TkA02G474750 · TK1151

Endoplasmic reticulum0.061

Rank 4 · TkA02G474750 · TK1151

Lysosome / Vacuole0.029

Rank 5 · TkA02G474750 · TK1151

LocPro · Direct prediction · Computational prediction, not experimental localization

Open Subcellular Module

Predicted Functional Domains

Domain results are from Pfam-A/HMMER; positions are amino-acid coordinates on the protein sequence.

PF05764YL174-128 aa

PF26289PH_3894-158 aa

PF00646F-box139-170 aa

PF12937F-box-like141-168 aa

PF26289PH_38175-240 aa

PF24750b-prop_At3g26010-like215-346 aa

PF08268FBA_3216-353 aa

PF07734FBA_1222-351 aa

Gene ID	Domain ID	Domain Name	Start aa	End aa	E-value	Score
TkA02G474750	`PF05764`	YL1	74	128	0.0044	17.9
TkA02G474750	`PF26289`	PH_38	94	158	0.22	12.3
TkA02G474750	`PF00646`	F-box	139	170	2.8e-06	27.7
TkA02G474750	`PF12937`	F-box-like	141	168	2e-06	28.2
TkA02G474750	`PF26289`	PH_38	175	240	0.22	12.3
TkA02G474750	`PF24750`	b-prop_At3g26010-like	215	346	4e-08	33.5
TkA02G474750	`PF08268`	FBA_3	216	353	1.7e-07	31.3
TkA02G474750	`PF07734`	FBA_1	222	351	1e-13	51.7
TkA02G474750	`PF07734`	FBA_1	455	468	1e-13	51.7

Arabidopsis / Rice Protein Homology

Only Arabidopsis and rice are shown. Swiss-Prot entries are reviewed; TrEMBL entries are supplementary sequence candidates. Similarity is not experimental validation.

Download current result

Protein	Organism	Description	Identity	Database	Confidence
`Q1KS79`	Arabidopsis thaliana	sp\|Q1KS79\|FB116_ARATH F-box protein At2g23160	25.000%	Swiss-Prot	Low

JBrowse

View in Genome Browser

Gene Card