TkA02G474580 | RubberDandelionOmics

Gene overview

TkA02G474580

Reference: TK1151 Chr: Chr02 Coordinates: 121133692-121138336 Strand: + Type: protein_coding

cDNA / CDS / Protein Sequences

Available sequence downloads CDS FASTA Protein FASTA cDNA FASTA

cDNA

2217 bp · TkA02G474580|TK1151|cDNA

ATTAATTAGATCGGATTTTCGGATTCGGATACATTTAAACACCCCTCCATGTAGCAACCTAAATCAGACTTATGCAGAACGGATTATAAAAGACAAAAGATAGATGGTAGAGTATATTCGAGGGACCATTCGTGAACAATGTGAAAGACAAGTTTTGCCGCCAGTTGGGTCCACTCTTCCCATTTTATCTTTCGCTTCAATTGTGAGGGAGATAAAGGATTCCAGTAACGACGATGCATCAATGGCGAACCCTAAATTCA...

CDS

Download CDS FASTA

771 bp · TkA02G474580|TK1151|CDS

ATGGTAGAGTATATTCGAGGGACCATTCGTGAACAATGTGAAAGACAAGTTTTGCCGCCAGTTGGGTCCACTCTTCCCATTTTATCTTTCGCTTCAATTGTGAGGGAGATAAAGGATTCCAGTAACGACGATGCATCAATGGCGAACCCTAAATTCAAGATGAAAAATGCAAAGATAATATTGGGTTCTTCTTCAATGGCTCGTCGGAAAATCTTAGCGGAGATGGAGTATGATTTTAAAATCATGACTGCAGATATTGA...

Protein

Download Protein FASTA

256 aa · TkA02G474580|TK1151|PROTEIN

MVEYIRGTIREQCERQVLPPVGSTLPILSFASIVREIKDSSNDDASMANPKFKMKNAKIILGSSSMARRKILAEMEYDFKIMTADIDEKSIRRERPEDLVVALAEAKADAIISRLGISGYKEENTHPTLLITADTVVVYEGTIREKPSSKEEARHFVKGYSGGCAIVVGSVVVTNLTTGIKKLGWDRSEVYFHDIPDEAIDKLVDEGVTLNVAGGLMLEHPLTAPFVDTVIGTSDGVMGLSKSLTEKLIEESLEFL

Flanking Sequence Download

Sequence orientation and download details

Upstream/downstream are capped at 10000 bp per side. Negative-strand genes are reverse-complemented so the final FASTA follows transcriptional 5′→3′ orientation.

ID Mapping

Input ID	`TkA02G474580`
TK1151 ID	TkA02G474580
OH-1004 ID	LXL04_013740
Relationship / confidence	Rbh High Identity Coverage Synteny / Strict
Protein identity (%)	99.600
Protein coverage (%)	TK1151 100.000 / OH-1004 100.000 Coverage and evidence Coverage is the aligned span of the best-scoring HSP divided by representative protein length. A homolog match does not establish functional validation.
Source version	TK1151 / GWHBCHF00000000

Open Full ID Mapping

SNP / Indel variants and carrier samplesCRA009020 · TK1151

Expand to load variant records for this gene.

Basic Information and Functional Annotation

Gene ID	`TkA02G474580`
Location	Chr02:121133692-121138336 (+)
Description	Similar to DDB_G0281937: 7-methyl-GTP pyrophosphatase
Arabidopsis / Rice Reference Genes and Papers	Download references for this gene Arabidopsis No hit for this species in the current source table. Rice No hit for this species in the current source table.
Functional annotation source	View annotation sources Functional annotation source: OH1004 · `LXL04_013740` · GCA_047496595.1_OSU_TarKok_2.0. These OH1004 annotations are retrieved through ID mapping; the Arabidopsis/rice table below uses protein alignments from the query reference.
GO annotations (OH1004 source)	GO:0009117 nucleotide metabolic process Biological Process GO:0005737 cytoplasm Cellular Component GO:0036218 dTTP diphosphatase activity Molecular Function GO:0036221 UTP diphosphatase activity Molecular Function GO:0047429 nucleoside triphosphate diphosphatase activity Molecular Function
KEGG gene cross-reference	amt:Amet_2288 ava:Ava_0836 csc:Csac_1865 ddi:DDB_G0281937 syx:SynWH7803_1656 These KEGG gene identifiers are linked through homologous proteins; they do not establish pathway function for this gene.

Open Annotation Module

Gene expression

View expression in different studies, tissues and treatments. Results are presented separately by study and measurement unit.

View expression for this gene

Data sources and gene correspondence

Expression data come from public transcriptome studies. Reference genomes, sample metadata and measurement units are shown with the results. Ambiguous cross-reference correspondences do not select an expression record automatically; missing values do not mean zero expression.

Subcellular Localization Top 5

Computational predictions or homology annotations below do not replace localization experiments.

Cytoplasm0.641

Rank 1 · TkA02G474580 · TK1151

Nucleus0.273

Rank 2 · TkA02G474580 · TK1151

Cell membrane0.102

Rank 3 · TkA02G474580 · TK1151

Plastid0.077

Rank 4 · TkA02G474580 · TK1151

Mitochondrion0.073

Rank 5 · TkA02G474580 · TK1151

LocPro · Direct prediction · Computational prediction, not experimental localization

Open Subcellular Module

Predicted Functional Domains

Domain results are from Pfam-A/HMMER; positions are amino-acid coordinates on the protein sequence.

PF02545Maf58-251 aa

PF12964DUF3853131-175 aa

Gene ID	Domain ID	Domain Name	Start aa	End aa	E-value	Score
TkA02G474580	`PF02545`	Maf	58	251	5.4e-41	141.0
TkA02G474580	`PF12964`	DUF3853	131	175	0.13	13.3

Arabidopsis / Rice Protein Homology

Only Arabidopsis and rice are shown. Swiss-Prot entries are reviewed; TrEMBL entries are supplementary sequence candidates. Similarity is not experimental validation.

Download current result

No result was found for this query.

JBrowse

View in Genome Browser

Gene Card