TkA02G474010 | RubberDandelionOmics

Gene overview

TkA02G474010

Reference: TK1151 Chr: Chr02 Coordinates: 120988612-120993963 Strand: - Type: protein_coding

cDNA / CDS / Protein Sequences

Available sequence downloads CDS FASTA Protein FASTA cDNA FASTA

cDNA

4208 bp · TkA02G474010|TK1151|cDNA

TTCGTTTCTCCTTTCTTTTTGACCAAAAAAAAAAACACTCTTTCTTTCTCTTTCGTCAAGACGACTTGTTTTTGTATTCAATTTTTTGGTGCTCTACTGCGTATGATGACGACTACAAGGGACCAAAAAAAACCAGTAAAGACCATAGCTCATGGTGGTAGACCCACCCCATAGACCCCAAACCTCAGCCCCAAAGATTCCGATATTAAATCGCTATGCGCCTATGCCCCATGAAAAGTCTCTATTTGAGTCTGTTTCTG...

CDS

Download CDS FASTA

2133 bp · TkA02G474010|TK1151|CDS

ATGGGGAGTGACGCTCCTGACACTGTGGAGAGACTCAGACTGCCATCGCCGACGAACATCAAGGTTCATCGTTTTATGTGTACAGAGCTTATGAAGCCAGTCGAAAGTGTTCATAAAATATTCTCCGAAATAGAAGCAGCCAGACCAAGATGCGAATATGGTATTAAGTCACTTGTCCAGTTAAGCGTTGCACTTGATAAAGCCAGAACATTGATTCGAGACTGCAGTGAATCGAGTAAACTTTACTTGGCGTTCGCAGG...

Protein

Download Protein FASTA

710 aa · TkA02G474010|TK1151|PROTEIN

MGSDAPDTVERLRLPSPTNIKVHRFMCTELMKPVESVHKIFSEIEAARPRCEYGIKSLVQLSVALDKARTLIRDCSESSKLYLAFAGTTILSRCKNAIKLLEQSLNQLQNMVPVLLASKISQIITEIKRVKISLHPSEEEAGKSVKGILEGYRMGNSSQNENVYECIRIIALKLQLTSSTALLIEQRSIKKLLIQLREEENKQQKKQILTILLNVLKNHGNLFTSVNVDNNSIVQNQEYGSRRVDSYVDREEPPKGITGI...

Flanking Sequence Download

Sequence orientation and download details

Upstream/downstream are capped at 10000 bp per side. Negative-strand genes are reverse-complemented so the final FASTA follows transcriptional 5′→3′ orientation.

ID Mapping

Input ID	`TkA02G474010`
TK1151 ID	TkA02G474010
OH-1004 ID	LXL04_013745
Relationship / confidence	Multi Source To Oh1004 / Complex relationship
Protein identity (%)	98.600
Protein coverage (%)	TK1151 100.000 / OH-1004 100.000 Coverage and evidence Coverage is the aligned span of the best-scoring HSP divided by representative protein length. A homolog match does not establish functional validation.
Source version	TK1151 / GWHBCHF00000000

Open Full ID Mapping

SNP / Indel variants and carrier samplesCRA009020 · TK1151

Expand to load variant records for this gene.

Basic Information and Functional Annotation

Gene ID TkA02G474010

Location Chr02:120988612-120993963 (-)

Description Similar to PUB5: U-box domain-containing protein 5

Arabidopsis / Rice Reference Genes and Papers

Download references for this gene

Arabidopsis

Reference gene ID	Possible function	Papers / DOI
`At4g36550`	Functions as an E3 ubiquitin ligase.	No verified direct reference in this release
`At1g27910`	Functions as an E3 ubiquitin ligase.	No verified direct reference in this release
`At1g67530`	Functions as an E3 ubiquitin ligase.	No verified direct reference in this release
`At1g24330`	Functions as an E3 ubiquitin ligase.	No verified direct reference in this release
`At3g07360`	Functions as an E3 ubiquitin ligase (By similarity).	Interactions between the S-domain receptor kinases and AtPUB-ARM E3 ubiquitin ligases suggest a conserved signaling pathway in Arabidopsis.2008 · DOI: 10.1104/pp.108.123380

Rice

No hit for this species in the current source table.

Functional annotation source

View annotation sources

Functional annotation source: OH1004 · LXL04_013745 · GCA_047496595.1_OSU_TarKok_2.0. These OH1004 annotations are retrieved through ID mapping; the Arabidopsis/rice table below uses protein alignments from the query reference.

GO annotations (OH1004 source)

GO:0007166 cell surface receptor signaling pathway Biological Process

GO:0016567 protein ubiquitination Biological Process

GO:0042742 defense response to bacterium Biological Process

GO:0050777 negative regulation of immune response Biological Process

GO:2000028 regulation of photoperiodism, flowering Biological Process

GO:0005634 nucleus Cellular Component

GO:0005737 cytoplasm Cellular Component

GO:0005739 mitochondrion Cellular Component

GO:0005829 cytosol Cellular Component

GO:0009507 chloroplast Cellular Component

GO:0004842 ubiquitin-protein transferase activity Molecular Function

GO:0061630 ubiquitin protein ligase activity Molecular Function

KEGG gene cross-reference

ath:AT1G24330

ath:AT1G27910

ath:AT1G67530

ath:AT3G46510

ath:AT4G36550

These KEGG gene identifiers are linked through homologous proteins; they do not establish pathway function for this gene.

Open Annotation Module

Gene expression

View expression in different studies, tissues and treatments. Results are presented separately by study and measurement unit.

View expression for this gene

Data sources and gene correspondence

Expression data come from public transcriptome studies. Reference genomes, sample metadata and measurement units are shown with the results. Ambiguous cross-reference correspondences do not select an expression record automatically; missing values do not mean zero expression.

Subcellular Localization Top 5

Computational predictions or homology annotations below do not replace localization experiments.

Cytoplasm0.574

Rank 1 · TkA02G474010 · TK1151

Nucleus0.345

Rank 2 · TkA02G474010 · TK1151

Cell membrane0.228

Rank 3 · TkA02G474010 · TK1151

Endoplasmic reticulum0.053

Rank 4 · TkA02G474010 · TK1151

Golgi apparatus0.036

Rank 5 · TkA02G474010 · TK1151

LocPro · Direct prediction · Computational prediction, not experimental localization

Open Subcellular Module

Predicted Functional Domains

Domain results are from Pfam-A/HMMER; positions are amino-acid coordinates on the protein sequence.

PF19584MCAfunc22-132 aa

PF05659RPW825-134 aa

PF20457DUF6710144-206 aa

PF24768ARM_ARMC5155-219 aa

PF05659RPW8183-202 aa

PF04564U-box262-330 aa

PF11789zf-Nse264-304 aa

PF24768ARM_ARMC5449-631 aa

Gene ID	Domain ID	Domain Name	Start aa	End aa	E-value	Score
TkA02G474010	`PF19584`	MCAfunc	22	132	0.0088	16.5
TkA02G474010	`PF05659`	RPW8	25	134	0.0076	16.6
TkA02G474010	`PF20457`	DUF6710	144	206	0.6	10.3
TkA02G474010	`PF24768`	ARM_ARMC5	155	219	2.8e-08	34.2
TkA02G474010	`PF05659`	RPW8	183	202	0.0076	16.6
TkA02G474010	`PF04564`	U-box	262	330	1.8e-17	64.0
TkA02G474010	`PF11789`	zf-Nse	264	304	0.016	15.7
TkA02G474010	`PF24768`	ARM_ARMC5	449	631	2.8e-08	34.2
TkA02G474010	`PF22242`	6PGD_like	462	499	0.27	12.4
TkA02G474010	`PF20457`	DUF6710	499	540	0.6	10.3
TkA02G474010	`PF22242`	6PGD_like	566	609	0.27	12.4
TkA02G474010	`PF20457`	DUF6710	578	621	0.6	10.3

Arabidopsis / Rice Protein Homology

Only Arabidopsis and rice are shown. Swiss-Prot entries are reviewed; TrEMBL entries are supplementary sequence candidates. Similarity is not experimental validation.

Download current result

Protein	Organism	Description	Identity	Database	Confidence
`O23225`	Arabidopsis thaliana	sp\|O23225\|PUB5_ARATH U-box domain-containing protein 5	35.400%	Swiss-Prot	Medium
`Q9C7G1`	Arabidopsis thaliana	sp\|Q9C7G1\|PUB45_ARATH U-box domain-containing protein 45	30.100%	Swiss-Prot	Medium
`Q9CAG5`	Arabidopsis thaliana	sp\|Q9CAG5\|PUB7_ARATH U-box domain-containing protein 7	29.900%	Swiss-Prot	Low
`O48700`	Arabidopsis thaliana	sp\|O48700\|PUB6_ARATH U-box domain-containing protein 6	29.200%	Swiss-Prot	Low
`Q9SRT0`	Arabidopsis thaliana	sp\|Q9SRT0\|PUB9_ARATH U-box domain-containing protein 9	50.000%	Swiss-Prot	Low

JBrowse

View in Genome Browser

Gene Card