TkA02G468790 | RubberDandelionOmics

Gene overview

TkA02G468790

Reference: TK1151 Chr: Chr02 Coordinates: 119552564-119558317 Strand: - Type: protein_coding

cDNA / CDS / Protein Sequences

Available sequence downloads CDS FASTA Protein FASTA cDNA FASTA

cDNA

4767 bp · TkA02G468790|TK1151|cDNA

AAACTACTAATCCTTTTTTTTATTCGTGTGCAAACGACTATAAAAAGGATTTTAGAATATCTAATCTATCAGAATATTAGATATGTACAAAATCAGTCTTATATATTTGTTTTCTTGCGACAAAGACTAACGAAACGAAGGCGGTGCTTTGGAATTACGTTGTTTCTCATTCTTTTTTTTGGATCTCTTCTAGGAAAACCAAGTTTTCTGTTAACTGATTTCTAATTTGTAACTTTCTAGCTTCTGCTGGTTTTCTTTAT...

CDS

Download CDS FASTA

2547 bp · TkA02G468790|TK1151|CDS

ATGGCGGTTAATTCTTCAGCGAAAGTTGTGCTCTTACATGGTGACTTATATCTCCAAGTTATCGAAGCTCAAAACTTACCGAATATGGATGTAATCACCGGCCACATCCTCCGTTGCGTGTCCTTTGATTCTTGCCCGGAAGACACCACCCCCGCCGGGTCCGAGGACTTGAAACTGCGCTCCAGCGGGCGGAAGATCATTGCTAGTGATCCTTACGTGAAAGTATCCGTGCCTCAAGCAGCCGTCGCACGTACACGCGT...

Protein

Download Protein FASTA

848 aa · TkA02G468790|TK1151|PROTEIN

MAVNSSAKVVLLHGDLYLQVIEAQNLPNMDVITGHILRCVSFDSCPEDTTPAGSEDLKLRSSGRKIIASDPYVKVSVPQAAVARTRVLKNSKNPRWNERFDIPLAHELVYLEFEVKDDDIFGADLLGIVHISAEEIATGKVISGWFPLKNCRKEALLRLEMKFVPCESNPLYLHGIAGDPELKGVRNTYFPVRKGSQVTLYQDAHIMPKSMMPKIELDGGKVYEHNSCWEDICHAISSAHHMIYIVGWSIFHKIKLIREP...

Flanking Sequence Download

Sequence orientation and download details

Upstream/downstream are capped at 10000 bp per side. Negative-strand genes are reverse-complemented so the final FASTA follows transcriptional 5′→3′ orientation.

ID Mapping

Input ID	`TkA02G468790`
TK1151 ID	TkA02G468790
OH-1004 ID	LXL04_013842
Relationship / confidence	Rbh High Identity Coverage Synteny / Strict
Protein identity (%)	100.000
Protein coverage (%)	TK1151 100.000 / OH-1004 100.000 Coverage and evidence Coverage is the aligned span of the best-scoring HSP divided by representative protein length. A homolog match does not establish functional validation.
Source version	TK1151 / GWHBCHF00000000

Open Full ID Mapping

SNP / Indel variants and carrier samplesCRA009020 · TK1151

Expand to load variant records for this gene.

Basic Information and Functional Annotation

Gene ID TkA02G468790

Location Chr02:119552564-119558317 (-)

Description Similar to PLDDELTA: Phospholipase D delta

Arabidopsis / Rice Reference Genes and Papers

Download references for this gene

Arabidopsis

Reference gene ID	Possible function	Papers / DOI
`At4g35790`	Hydrolyzes glycerol-phospholipids at the terminal phosphodiesteric bond to generate phosphatidic acids (PA).	Involvement of a novel Arabidopsis phospholipase D, AtPLDdelta, in dehydration-inducible accumulation of phosphatidic acid in stress signalling.2001 · DOI: 10.1046/j.1365-313x.2001.01060.x Kinetic analysis of Arabidopsis phospholipase Ddelta. Substrate preference and mechanism of activation by Ca2+ and phosphatidylinositol 4,5-biphosphate.2002 · DOI: 10.1074/jbc.m209598200
`At2g42010`	Hydrolyzes glycerol-phospholipids at the terminal phosphodiesteric bond to generate phosphatidic acids (PA).	No verified direct reference in this release
`At4g11840`	Hydrolyzes glycerol-phospholipids at the terminal phosphodiesteric bond to generate phosphatidic acids (PA).	No verified direct reference in this release
`At4g11850`	Hydrolyzes glycerol-phospholipids at the terminal phosphodiesteric bond to generate phosphatidic acids (PA).	Expression and characterization of Arabidopsis phospholipase Dgamma2.2006 · DOI: 10.1016/j.bbalip.2006.09.017
`At4g11830`	Hydrolyzes glycerol-phospholipids at the terminal phosphodiesteric bond to generate phosphatidic acids (PA).	Expression and characterization of Arabidopsis phospholipase Dgamma2.2006 · DOI: 10.1016/j.bbalip.2006.09.017

Rice

No hit for this species in the current source table.

Functional annotation source

View annotation sources

Functional annotation source: OH1004 · LXL04_013842 · GCA_047496595.1_OSU_TarKok_2.0. These OH1004 annotations are retrieved through ID mapping; the Arabidopsis/rice table below uses protein alignments from the query reference.

GO annotations (OH1004 source)

GO:0006643 membrane lipid metabolic process Biological Process

GO:0006979 response to oxidative stress Biological Process

GO:0009395 phospholipid catabolic process Biological Process

GO:0009409 response to cold Biological Process

GO:0009789 positive regulation of abscisic acid-activated signaling pathway Biological Process

GO:0009793 embryo development ending in seed dormancy Biological Process

GO:0010044 response to aluminum ion Biological Process

GO:0012501 programmed cell death Biological Process

GO:0042742 defense response to bacterium Biological Process

GO:0045087 innate immune response Biological Process

GO:0046470 phosphatidylcholine metabolic process Biological Process

GO:0046473 phosphatidic acid metabolic process Biological Process

KEGG gene cross-reference

ath:AT2G42010

ath:AT4G11830

ath:AT4G11840

ath:AT4G11850

ath:AT4G35790

These KEGG gene identifiers are linked through homologous proteins; they do not establish pathway function for this gene.

Open Annotation Module

Gene expression

View expression in different studies, tissues and treatments. Results are presented separately by study and measurement unit.

View expression for this gene

Data sources and gene correspondence

Expression data come from public transcriptome studies. Reference genomes, sample metadata and measurement units are shown with the results. Ambiguous cross-reference correspondences do not select an expression record automatically; missing values do not mean zero expression.

Subcellular Localization Top 5

Computational predictions or homology annotations below do not replace localization experiments.

Cytoplasm0.496

Rank 1 · TkA02G468790 · TK1151

Cell membrane0.254

Rank 2 · TkA02G468790 · TK1151

Nucleus0.211

Rank 3 · TkA02G468790 · TK1151

Golgi apparatus0.143

Rank 4 · TkA02G468790 · TK1151

Lysosome / Vacuole0.137

Rank 5 · TkA02G468790 · TK1151

LocPro · Direct prediction · Computational prediction, not experimental localization

Open Subcellular Module

Predicted Functional Domains

Domain results are from Pfam-A/HMMER; positions are amino-acid coordinates on the protein sequence.

PF00168C215-148 aa

PF13091PLDc_2233-374 aa

PF00614PLDc235-836 aa

PF00168C2282-310 aa

PF00168C2527-539 aa

PF13091PLDc_2552-571 aa

PF00168C2686-721 aa

PF13091PLDc_2693-731 aa

Gene ID	Domain ID	Domain Name	Start aa	End aa	E-value	Score
TkA02G468790	`PF00168`	C2	15	148	2e-20	73.7
TkA02G468790	`PF13091`	PLDc_2	233	374	1.5e-09	38.4
TkA02G468790	`PF00614`	PLDc	235	836	2.6e-211	703.5
TkA02G468790	`PF00168`	C2	282	310	2e-20	73.7
TkA02G468790	`PF00168`	C2	527	539	2e-20	73.7
TkA02G468790	`PF13091`	PLDc_2	552	571	1.5e-09	38.4
TkA02G468790	`PF00168`	C2	686	721	2e-20	73.7
TkA02G468790	`PF13091`	PLDc_2	693	731	1.5e-09	38.4

Arabidopsis / Rice Protein Homology

Only Arabidopsis and rice are shown. Swiss-Prot entries are reviewed; TrEMBL entries are supplementary sequence candidates. Similarity is not experimental validation.

Download current result

Protein	Organism	Description	Identity	Database	Confidence
`Q9C5Y0`	Arabidopsis thaliana	sp\|Q9C5Y0\|PLDD1_ARATH Phospholipase D delta	66.700%	Swiss-Prot	High
`P93733`	Arabidopsis thaliana	sp\|P93733\|PLDB1_ARATH Phospholipase D beta 1	51.900%	Swiss-Prot	High
`Q9T052`	Arabidopsis thaliana	sp\|Q9T052\|PLDG3_ARATH Phospholipase D gamma 3	50.800%	Swiss-Prot	High
`Q9T053`	Arabidopsis thaliana	sp\|Q9T053\|PLDG1_ARATH Phospholipase D gamma 1	50.900%	Swiss-Prot	High
`Q9T051`	Arabidopsis thaliana	sp\|Q9T051\|PLDG2_ARATH Phospholipase D gamma 2	49.700%	Swiss-Prot	Medium

JBrowse

View in Genome Browser

Gene Card