TkA02G468780 | RubberDandelionOmics

Gene overview

TkA02G468780

Reference: TK1151 Chr: Chr02 Coordinates: 119549907-119552289 Strand: + Type: protein_coding

cDNA / CDS / Protein Sequences

Available sequence downloads CDS FASTA Protein FASTA cDNA FASTA

cDNA

1073 bp · TkA02G468780|TK1151|cDNA

AAAAGAAAGATCTGATGCAAAACCCTTGAAGAGCCTAAAACTAAAATCGCGATCTAGGGTTCTTGTCTGTAAGAAATGGCCGATTCTCCTCGACGAAGGTTTTCACGGTCTCCTCCCTATGAAGCACCATCCAGGTCTCGGTCCAGGTCAAGGTCAAGATCCAGGTCAAGATCCTGGTCAAGGCCAAGAGGCAGGCCTGCATCAAGATCAAGATCCAGAAGCCGTGGAAGGGAAGAGGTCGTAAATCCCGGAAATACCCT...

CDS

Download CDS FASTA

774 bp · TkA02G468780|TK1151|CDS

ATGGCCGATTCTCCTCGACGAAGGTTTTCACGGTCTCCTCCCTATGAAGCACCATCCAGGTCTCGGTCCAGGTCAAGGTCAAGATCCAGGTCAAGATCCTGGTCAAGGCCAAGAGGCAGGCCTGCATCAAGATCAAGATCCAGAAGCCGTGGAAGGGAAGAGGTCGTAAATCCCGGAAATACCCTTTACGTAACTGGCCTCTCTACACGTGTCACACAGGAACAGCTCGAAGAACATTTTTCAAAAGAAGGAAAGGTGGC...

Protein

Download Protein FASTA

257 aa · TkA02G468780|TK1151|PROTEIN

MADSPRRRFSRSPPYEAPSRSRSRSRSRSRSRSWSRPRGRPASRSRSRSRGREEVVNPGNTLYVTGLSTRVTQEQLEEHFSKEGKVANCFLVVEPRSRVSRGFAFITMDSTEDANRCIKHLNQSVLEHRQITVERSRRKRPRTPTPGHYLGLKNTRDTGYRGDRGGGGGGGRYRGGSGREDYGYRRSPPPYRGGGGGRGYSPRRSPPPYRGGGGRERERDYSPRRSPYYGGRSRRERTRSPPYSPPYRSPERHYGRR

Flanking Sequence Download

Sequence orientation and download details

Upstream/downstream are capped at 10000 bp per side. Negative-strand genes are reverse-complemented so the final FASTA follows transcriptional 5′→3′ orientation.

ID Mapping

Input ID	`TkA02G468780`
TK1151 ID	TkA02G468780
OH-1004 ID	LXL04_013843
Relationship / confidence	Rbh High Identity Coverage Synteny / Strict
Protein identity (%)	100.000
Protein coverage (%)	TK1151 97.276 / OH-1004 98.425 Coverage and evidence Coverage is the aligned span of the best-scoring HSP divided by representative protein length. A homolog match does not establish functional validation.
Source version	TK1151 / GWHBCHF00000000

Open Full ID Mapping

SNP / Indel variants and carrier samplesCRA009020 · TK1151

Expand to load variant records for this gene.

Basic Information and Functional Annotation

Gene ID TkA02G468780

Location Chr02:119549907-119552289 (+)

Description Similar to SR45A: Serine/arginine-rich splicing factor SR45a

Arabidopsis / Rice Reference Genes and Papers

Download references for this gene

Arabidopsis

Reference gene ID	Possible function	Papers / DOI
`At1g07350`	Probable splicing factor involved in constitutive and/or alternative splicing events.	No verified direct reference in this release
`At2g37220`	Could be involved in splicing and/or processing of chloroplast RNA's.	No verified direct reference in this release

Rice

No hit for this species in the current source table.

Functional annotation source

View annotation sources

Functional annotation source: OH1004 · LXL04_013843 · GCA_047496595.1_OSU_TarKok_2.0. These OH1004 annotations are retrieved through ID mapping; the Arabidopsis/rice table below uses protein alignments from the query reference.

GO annotations (OH1004 source)

GO:0000302 response to reactive oxygen species Biological Process

GO:0000375 RNA splicing, via transesterification reactions Biological Process

GO:0000381 regulation of alternative mRNA splicing, via spliceosome Biological Process

GO:0000398 mRNA splicing, via spliceosome Biological Process

GO:0008380 RNA splicing Biological Process

GO:0009644 response to high light intensity Biological Process

GO:0043484 regulation of RNA splicing Biological Process

GO:0045292 mRNA cis splicing, via spliceosome Biological Process

GO:0048026 positive regulation of mRNA splicing, via spliceosome Biological Process

GO:0071333 cellular response to glucose stimulus Biological Process

GO:0005634 nucleus Cellular Component

GO:0005637 nuclear inner membrane Cellular Component

KEGG gene cross-reference

ath:AT1G07350

hsa:6434

mmu:20462

rno:117259

These KEGG gene identifiers are linked through homologous proteins; they do not establish pathway function for this gene.

Open Annotation Module

Gene expression

View expression in different studies, tissues and treatments. Results are presented separately by study and measurement unit.

View expression for this gene

Data sources and gene correspondence

Expression data come from public transcriptome studies. Reference genomes, sample metadata and measurement units are shown with the results. Ambiguous cross-reference correspondences do not select an expression record automatically; missing values do not mean zero expression.

Subcellular Localization Top 5

Computational predictions or homology annotations below do not replace localization experiments.

Nucleus0.975

Rank 1 · TkA02G468780 · TK1151

Cytoplasm0.155

Rank 2 · TkA02G468780 · TK1151

Cell membrane0.014

Rank 3 · TkA02G468780 · TK1151

Mitochondrion0.009

Rank 4 · TkA02G468780 · TK1151

Extracellular0.008

Rank 5 · TkA02G468780 · TK1151

LocPro · Direct prediction · Computational prediction, not experimental localization

Open Subcellular Module

Predicted Functional Domains

Domain results are from Pfam-A/HMMER; positions are amino-acid coordinates on the protein sequence.

PF00937CoV_nucleocap19-56 aa

PF22976RRM_1054-129 aa

PF13893RRM_560-139 aa

PF16842RRM_occluded60-133 aa

PF00076RRM_162-131 aa

Gene ID	Domain ID	Domain Name	Start aa	End aa	E-value	Score
TkA02G468780	`PF00937`	CoV_nucleocap	19	56	0.0018	18.2
TkA02G468780	`PF22976`	RRM_10	54	129	0.071	14.0
TkA02G468780	`PF13893`	RRM_5	60	139	0.0075	16.7
TkA02G468780	`PF16842`	RRM_occluded	60	133	0.04	14.5
TkA02G468780	`PF00076`	RRM_1	62	131	1.8e-16	60.5

Arabidopsis / Rice Protein Homology

Only Arabidopsis and rice are shown. Swiss-Prot entries are reviewed; TrEMBL entries are supplementary sequence candidates. Similarity is not experimental validation.

Download current result

Protein	Organism	Description	Identity	Database	Confidence
`Q84TH4`	Arabidopsis thaliana	sp\|Q84TH4\|SR45A_ARATH Serine/arginine-rich splicing factor SR45a	64.000%	Swiss-Prot	Low
`Q9ZUU4`	Arabidopsis thaliana	sp\|Q9ZUU4\|CP29B_ARATH RNA-binding protein CP29B, chloroplastic	37.300%	Swiss-Prot	Low

JBrowse

View in Genome Browser

Gene Card