TkA02G463370 | RubberDandelionOmics

Gene overview

TkA02G463370

Reference: TK1151 Chr: Chr02 Coordinates: 118034998-118036855 Strand: - Type: protein_coding

cDNA / CDS / Protein Sequences

Available sequence downloads CDS FASTA Protein FASTA cDNA FASTA

cDNA

1285 bp · TkA02G463370|TK1151|cDNA

AGACAACAAGCGGCGTTATTATTGACAATTTGTCTCCTTGAAGCAAAAAAAGAAATCCATCTCTGCAACTCCCCTTTATAAATTTCCCAATCTTCTACGCAAATTTTAGCCACACGAAATGGCCGCTAAATGCAGTATCCCAGTCATCGATCTACATGATTTCCCCAATCAGTTATCCAAATTGATCTCAGCATGCGAAGAATGGGGCTGTTTCCGGCTACTCAACCACCAAGAAGTTCTCCCGCCGACGCTGATGTCGG...

CDS

Download CDS FASTA

918 bp · TkA02G463370|TK1151|CDS

ATGGCCGCTAAATGCAGTATCCCAGTCATCGATCTACATGATTTCCCCAATCAGTTATCCAAATTGATCTCAGCATGCGAAGAATGGGGCTGTTTCCGGCTACTCAACCACCAAGAAGTTCTCCCGCCGACGCTGATGTCGGAGATGAAGGCAGTAGTCAGATCACTCTTCGATTTACCGGTGGAGATCAAACGCCAGAACACCGACGTCATCACCGGAAGCGGATATATGGCTCCGACGGCGAAAAATCCGCTCTACGA...

Protein

Download Protein FASTA

305 aa · TkA02G463370|TK1151|PROTEIN

MAAKCSIPVIDLHDFPNQLSKLISACEEWGCFRLLNHQEVLPPTLMSEMKAVVRSLFDLPVEIKRQNTDVITGSGYMAPTAKNPLYEALGLYDMSSPRDVETFCSQLDASPNQRDTIMGYAGAVHELFMGIGKKLAEGLGVKSENIGFEKWPCQFRINKYHFTPDSVGSPGVQIHTDSGFLTVLQDDEGVGGLEVMNKSGEFIAVDPWPGTLLVNLGDMATIWSNGRFCNVKHRVQCKEAKIRVSIASFLLGPREAVEPL...

Flanking Sequence Download

Sequence orientation and download details

Upstream/downstream are capped at 10000 bp per side. Negative-strand genes are reverse-complemented so the final FASTA follows transcriptional 5′→3′ orientation.

ID Mapping

Input ID	`TkA02G463370`
TK1151 ID	TkA02G463370
OH-1004 ID	LXL04_013930
Relationship / confidence	Rbh High Identity Coverage Synteny / Strict
Protein identity (%)	99.300
Protein coverage (%)	TK1151 97.705 / OH-1004 84.659 Coverage and evidence Coverage is the aligned span of the best-scoring HSP divided by representative protein length. A homolog match does not establish functional validation.
Source version	TK1151 / GWHBCHF00000000

Open Full ID Mapping

SNP / Indel variants and carrier samplesCRA009020 · TK1151

Expand to load variant records for this gene.

Basic Information and Functional Annotation

Gene ID TkA02G463370

Location Chr02:118034998-118036855 (-)

Description Similar to DAO: 2-oxoglutarate-dependent dioxygenase DAO

Arabidopsis / Rice Reference Genes and Papers

Download references for this gene

Arabidopsis

Reference gene ID	Possible function	Papers / DOI
`At1g80330`	Converts the inactive gibberellin (GA) precursors GA9 and GA20 in the bioactives gibberellins GA4 and GA1.	Purification and kinetic studies of recombinant gibberellin dioxygenases.2005 · DOI: 10.1186/1471-2229-5-19 Distinct and overlapping roles of two gibberellin 3-oxidases in Arabidopsis development.2006 · DOI: 10.1111/j.1365-313x.2005.02642.x

Rice

Reference gene ID	Possible function	Papers / DOI
`UniProt: Q01IX6`	2-oxoglutarate-dependent dioxygenase essential for auxin catabolism and maintenance of auxin homeostasis in reproductive organs.	No verified direct reference in this release
`Os04g0475600`	2-oxoglutarate-dependent dioxygenase essential for auxin catabolism and maintenance of auxin homeostasis in reproductive organs.	No verified direct reference in this release
`Os08g0560000`	Involved in the regulation of shoot development and salicylic acid (SA) homeostasis.	No verified direct reference in this release

Functional annotation source

View annotation sources

Functional annotation source: OH1004 · LXL04_013930 · GCA_047496595.1_OSU_TarKok_2.0. These OH1004 annotations are retrieved through ID mapping; the Arabidopsis/rice table below uses protein alignments from the query reference.

GO annotations (OH1004 source)

GO:0002238 response to molecule of fungal origin Biological Process

GO:0006952 defense response Biological Process

GO:0009805 coumarin biosynthetic process Biological Process

GO:0009852 auxin catabolic process Biological Process

GO:0042617 paclitaxel biosynthetic process Biological Process

GO:1900150 regulation of defense response to fungus Biological Process

GO:1900366 negative regulation of defense response to insect Biological Process

GO:2000022 regulation of jasmonic acid mediated signaling pathway Biological Process

GO:0005737 cytoplasm Cellular Component

GO:0005783 endoplasmic reticulum Cellular Component

GO:0005829 cytosol Cellular Component

GO:0005506 iron ion binding Molecular Function

KEGG gene cross-reference

ath:AT2G38240

dosa:Os04g0475600

These KEGG gene identifiers are linked through homologous proteins; they do not establish pathway function for this gene.

Open Annotation Module

Gene expression

View expression in different studies, tissues and treatments. Results are presented separately by study and measurement unit.

View expression for this gene

Data sources and gene correspondence

Expression data come from public transcriptome studies. Reference genomes, sample metadata and measurement units are shown with the results. Ambiguous cross-reference correspondences do not select an expression record automatically; missing values do not mean zero expression.

Subcellular Localization Top 5

Computational predictions or homology annotations below do not replace localization experiments.

Cytoplasm0.823

Rank 1 · TkA02G463370 · TK1151

Nucleus0.324

Rank 2 · TkA02G463370 · TK1151

Peroxisome0.052

Rank 3 · TkA02G463370 · TK1151

Endoplasmic reticulum0.052

Rank 4 · TkA02G463370 · TK1151

Mitochondrion0.046

Rank 5 · TkA02G463370 · TK1151

LocPro · Direct prediction · Computational prediction, not experimental localization

Open Subcellular Module

Predicted Functional Domains

Domain results are from Pfam-A/HMMER; positions are amino-acid coordinates on the protein sequence.

PF14226DIOX_N7-78 aa

PF031712OG-FeII_Oxy153-250 aa

Gene ID	Domain ID	Domain Name	Start aa	End aa	E-value	Score
TkA02G463370	`PF14226`	DIOX_N	7	78	7.5e-12	46.7
TkA02G463370	`PF03171`	2OG-FeII_Oxy	153	250	1.1e-23	84.2

Arabidopsis / Rice Protein Homology

Only Arabidopsis and rice are shown. Swiss-Prot entries are reviewed; TrEMBL entries are supplementary sequence candidates. Similarity is not experimental validation.

Download current result

Protein	Organism	Description	Identity	Database	Confidence
`Q9C971`	Arabidopsis thaliana	sp\|Q9C971\|G3OX4_ARATH Gibberellin 3-beta-dioxygenase 4	29.500%	Swiss-Prot	Low
`Q01IX6`	Oryza sativa subsp. indica	sp\|Q01IX6\|DAO_ORYSI 2-oxoglutarate-dependent dioxygenase DAO	53.800%	Swiss-Prot	High
`Q7XKU5`	Oryza sativa subsp. japonica	sp\|Q7XKU5\|DAO_ORYSJ 2-oxoglutarate-dependent dioxygenase DAO	53.800%	Swiss-Prot	High
`Q6YYX9`	Oryza sativa subsp. japonica	sp\|Q6YYX9\|SLC1_ORYSJ Probable 2-oxoglutarate-dependent dioxygenase SLC1	33.100%	Swiss-Prot	Medium

JBrowse

View in Genome Browser

Gene Card