RubberDandelionOmics Rubber Dandelion Multi-omics Website
More
Transcriptome Expression Annotation Rubber Pathway TF Prediction Targets Protein Network Resequencing Tools Downloads
ZH EN

How to use this page

Gene Card

Enter a TK1151 or OH-1004 gene ID to view sequences, annotations and analyses in the corresponding reference genome.
Flanking length, max 10000 bp
Examples TkA01G624900 LXL04_000258

Gene overview

TkA02G462840
Reference: TK1151 Chr: Chr02 Coordinates: 117925426-117926496 Strand: + Type: protein_coding

cDNA / CDS / Protein Sequences

Available sequence downloads CDS FASTA Protein FASTA cDNA FASTA

cDNA

Download cDNA FASTA

363 bp · TkA02G462840|TK1151|cDNA

ATGATAATCCTGGAAGGCCATCCTGCCGAACCGAAGTGTCGAGCCCAACCGAGGTACCAAACCGAAACCTTCCAGTCAAGCCGAACCGAAGCGCCGAGTCCAACCGAGCGCGGGAAGAAGAAGATCTTCGATTTAACTTGTCTCATGGCGGCAAGAGAAGTAGAAGATGTAACAAAACCTTCGGTGACTGATGAAGAATTGGAAGACGACGACGAACACGATTCAAAAGAGGCAGTGTTTCAGAGATACTTTTTACTAGA...

CDS

Download CDS FASTA

363 bp · TkA02G462840|TK1151|CDS

ATGATAATCCTGGAAGGCCATCCTGCCGAACCGAAGTGTCGAGCCCAACCGAGGTACCAAACCGAAACCTTCCAGTCAAGCCGAACCGAAGCGCCGAGTCCAACCGAGCGCGGGAAGAAGAAGATCTTCGATTTAACTTGTCTCATGGCGGCAAGAGAAGTAGAAGATGTAACAAAACCTTCGGTGACTGATGAAGAATTGGAAGACGACGACGAACACGATTCAAAAGAGGCAGTGTTTCAGAGATACTTTTTACTAGA...

Protein

Download Protein FASTA

120 aa · TkA02G462840|TK1151|PROTEIN

MIILEGHPAEPKCRAQPRYQTETFQSSRTEAPSPTERGKKKIFDLTCLMAAREVEDVTKPSVTDEELEDDDEHDSKEAVFQRYFLLEWKVVKCILDDVISNGRVVDLSSVHKIRSIEKKM

Flanking Sequence Download

Sequence orientation and download details

Upstream/downstream are capped at 10000 bp per side. Negative-strand genes are reverse-complemented so the final FASTA follows transcriptional 5′→3′ orientation.

Download Gene (CDS) Download Protein

ID Mapping

Input IDTkA02G462840
TK1151 IDTkA02G462840
OH-1004 IDLXL04_026849
Relationship / confidenceNon Reciprocal Best Hit / Complex relationship
Protein identity (%)93.000
Protein coverage (%)TK1151 59.167 / OH-1004 5.685
Coverage and evidence

Coverage is the aligned span of the best-scoring HSP divided by representative protein length. A homolog match does not establish functional validation.

Source versionTK1151 / GWHBCHF00000000
Open Full ID Mapping
SNP / Indel variants and carrier samplesCRA009020 · TK1151

Expand to load variant records for this gene.

Basic Information and Functional Annotation

Gene IDTkA02G462840
LocationChr02:117925426-117926496 (+)
DescriptionSimilar to TFCD: Tubulin-folding cofactor D
Arabidopsis / Rice Reference Genes and Papers

Download references for this gene

Arabidopsis

Reference gene IDPossible functionPapers / DOI
At3g60740 Regulates microtubule function in seed development.
The titan mutants of Arabidopsis are disrupted in mitosis and cell cycle control during seed development.1998 · DOI: 10.1046/j.1365-313x.1998.00268.x

Rice

No hit for this species in the current source table.

Functional annotation source
View annotation sources

Functional annotation source: OH1004 · LXL04_026849 · GCA_047496595.1_OSU_TarKok_2.0. These OH1004 annotations are retrieved through ID mapping; the Arabidopsis/rice table below uses protein alignments from the query reference.

GO annotations (OH1004 source)
GO:0000226 microtubule cytoskeleton organization Biological Process
GO:0000278 mitotic cell cycle Biological Process
GO:0006457 protein folding Biological Process
GO:0007017 microtubule-based process Biological Process
GO:0007021 tubulin complex assembly Biological Process
GO:0007023 post-chaperonin tubulin folding pathway Biological Process
GO:0009793 embryo development ending in seed dormancy Biological Process
GO:0010812 negative regulation of cell-substrate adhesion Biological Process
GO:0031115 negative regulation of microtubule polymerization Biological Process
GO:0034333 adherens junction assembly Biological Process
GO:0070830 bicellular tight junction assembly Biological Process
GO:0005737 cytoplasm Cellular Component
KEGG gene cross-reference
ath:AT3G60740
bta:281515
gga:417334
hsa:6904
mmu:108903
These KEGG gene identifiers are linked through homologous proteins; they do not establish pathway function for this gene.
Open Annotation Module

Gene expression

View expression in different studies, tissues and treatments. Results are presented separately by study and measurement unit.

View expression for this gene
Data sources and gene correspondence

Expression data come from public transcriptome studies. Reference genomes, sample metadata and measurement units are shown with the results. Ambiguous cross-reference correspondences do not select an expression record automatically; missing values do not mean zero expression.

Subcellular Localization Top 5

Computational predictions or homology annotations below do not replace localization experiments.

Nucleus0.530
Rank 1 · TkA02G462840 · TK1151
Cytoplasm0.383
Rank 2 · TkA02G462840 · TK1151
Mitochondrion0.106
Rank 3 · TkA02G462840 · TK1151
Cell membrane0.080
Rank 4 · TkA02G462840 · TK1151
Endoplasmic reticulum0.050
Rank 5 · TkA02G462840 · TK1151

LocPro · Direct prediction · Computational prediction, not experimental localization

Open Subcellular Module

Predicted Functional Domains

No result was found for this query.

Arabidopsis / Rice Protein Homology

Only Arabidopsis and rice are shown. Swiss-Prot entries are reviewed; TrEMBL entries are supplementary sequence candidates. Similarity is not experimental validation.

Download current result

ProteinOrganismDescriptionIdentityDatabaseConfidence
Q8L5R3Arabidopsis thalianasp|Q8L5R3|TBCD_ARATH Tubulin-folding cofactor D74.100%Swiss-ProtLow

JBrowse

View in Genome Browser