TkA02G462150 | RubberDandelionOmics

Gene overview

TkA02G462150

Reference: TK1151 Chr: Chr02 Coordinates: 117755048-117756691 Strand: - Type: protein_coding

cDNA / CDS / Protein Sequences

Available sequence downloads CDS FASTA Protein FASTA cDNA FASTA

cDNA

1542 bp · TkA02G462150|TK1151|cDNA

ATGGAATCATTAAGGAATCCTAATGGAGCAAACTCAATCCCTCTAACTCCTCTTGGATTCCTCGAAAGAGCAGCCACCGTATACGCTGACTGCGACGTCGTATCAGTCCTCGCACCCAACATCCCCGCCACTTATGAGCTTCATTTTGCAGCCACCATGGCCGGCGCCGTAATCAACACCATTAACACCCGTTTAGATGCTCGCACTGTCTCAATACTCCTCCGTCACAGCGAATCCAAGCTCGTGTTTGTTGACTACCA...

CDS

Download CDS FASTA

1542 bp · TkA02G462150|TK1151|CDS

ATGGAATCATTAAGGAATCCTAATGGAGCAAACTCAATCCCTCTAACTCCTCTTGGATTCCTCGAAAGAGCAGCCACCGTATACGCTGACTGCGACGTCGTATCAGTCCTCGCACCCAACATCCCCGCCACTTATGAGCTTCATTTTGCAGCCACCATGGCCGGCGCCGTAATCAACACCATTAACACCCGTTTAGATGCTCGCACTGTCTCAATACTCCTCCGTCACAGCGAATCCAAGCTCGTGTTTGTTGACTACCA...

Protein

Download Protein FASTA

513 aa · TkA02G462150|TK1151|PROTEIN

MESLRNPNGANSIPLTPLGFLERAATVYADCDVVSVLAPNIPATYELHFAATMAGAVINTINTRLDARTVSILLRHSESKLVFVDYQLIRAIQEAISLLPGVCAHPQLVLITDDGPPSLPMDHFVDTYERMVESGDNCFDWVRPESDWDPLTLNYTSGTTSSPKGVVHSHRGTFIVAVDSLLEWGVPKQPVCLWTLPMFHANGWSYVWGMAAVGATNVCLRKFDASAMYSAIRNHKVTHMCGAPVVLNMLSTGKKLDHTV...

Flanking Sequence Download

Sequence orientation and download details

Upstream/downstream are capped at 10000 bp per side. Negative-strand genes are reverse-complemented so the final FASTA follows transcriptional 5′→3′ orientation.

ID Mapping

Input ID	`TkA02G462150`
TK1151 ID	TkA02G462150
OH-1004 ID	LXL04_013937
Relationship / confidence	Rbh Below Probable Coverage Or Synteny Threshold / Review
Protein identity (%)	93.400
Protein coverage (%)	TK1151 100.000 / OH-1004 100.000 Coverage and evidence Coverage is the aligned span of the best-scoring HSP divided by representative protein length. A homolog match does not establish functional validation.
Source version	TK1151 / GWHBCHF00000000

Open Full ID Mapping

SNP / Indel variants and carrier samplesCRA009020 · TK1151

Expand to load variant records for this gene.

Basic Information and Functional Annotation

Gene ID TkA02G462150

Location Chr02:117755048-117756691 (-)

Description Similar to AAE6: Probable acyl-activating enzyme 6

Arabidopsis / Rice Reference Genes and Papers

Download references for this gene

Arabidopsis

Reference gene ID	Possible function	Papers / DOI
`At5g16340`	May act as an acid--thiol ligase that activates carboxylic acids by forming acyl-CoAs.	No verified direct reference in this release
`At5g16370`	May act as an acid--thiol ligase that activates carboxylic acids by forming acyl-CoAs.	No verified direct reference in this release
`At1g75960`	May act as an acid--thiol ligase that activates carboxylic acids by forming acyl-CoAs.	No verified direct reference in this release

Rice

No hit for this species in the current source table.

Functional annotation source

View annotation sources

Functional annotation source: OH1004 · LXL04_013937 · GCA_047496595.1_OSU_TarKok_2.0. These OH1004 annotations are retrieved through ID mapping; the Arabidopsis/rice table below uses protein alignments from the query reference.

GO annotations (OH1004 source)

GO:0006631 fatty acid metabolic process Biological Process

GO:0009083 branched-chain amino acid catabolic process Biological Process

GO:0010025 wax biosynthetic process Biological Process

GO:0005777 peroxisome Cellular Component

GO:0005829 cytosol Cellular Component

GO:0009507 chloroplast Cellular Component

GO:0003987 acetate-CoA ligase activity Molecular Function

GO:0005524 ATP binding Molecular Function

GO:0016405 CoA-ligase activity Molecular Function

GO:0016874 ligase activity Molecular Function

GO:0031956 medium-chain fatty acid-CoA ligase activity Molecular Function

GO:0043759 2-methylbutanoate-CoA ligase activity Molecular Function

KEGG gene cross-reference

ath:AT1G21540

ath:AT5G16340

ath:AT5G16370

These KEGG gene identifiers are linked through homologous proteins; they do not establish pathway function for this gene.

Open Annotation Module

Gene expression

View expression in different studies, tissues and treatments. Results are presented separately by study and measurement unit.

View expression for this gene

Data sources and gene correspondence

Expression data come from public transcriptome studies. Reference genomes, sample metadata and measurement units are shown with the results. Ambiguous cross-reference correspondences do not select an expression record automatically; missing values do not mean zero expression.

Subcellular Localization Top 5

Computational predictions or homology annotations below do not replace localization experiments.

Peroxisome0.674

Rank 1 · TkA02G462150 · TK1151

Cytoplasm0.188

Rank 2 · TkA02G462150 · TK1151

Mitochondrion0.132

Rank 3 · TkA02G462150 · TK1151

Nucleus0.064

Rank 4 · TkA02G462150 · TK1151

Plastid0.050

Rank 5 · TkA02G462150 · TK1151

LocPro · Direct prediction · Computational prediction, not experimental localization

Open Subcellular Module

Predicted Functional Domains

Domain results are from Pfam-A/HMMER; positions are amino-acid coordinates on the protein sequence.

PF00501AMP-binding31-364 aa

PF23562AMP-binding_C_3402-436 aa

PF13193AMP-binding_C414-492 aa

Gene ID	Domain ID	Domain Name	Start aa	End aa	E-value	Score
TkA02G462150	`PF00501`	AMP-binding	31	364	2.5e-61	208.3
TkA02G462150	`PF23562`	AMP-binding_C_3	402	436	0.23	12.6
TkA02G462150	`PF13193`	AMP-binding_C	414	492	2.5e-25	89.9

Arabidopsis / Rice Protein Homology

Only Arabidopsis and rice are shown. Swiss-Prot entries are reviewed; TrEMBL entries are supplementary sequence candidates. Similarity is not experimental validation.

Download current result

Protein	Organism	Description	Identity	Database	Confidence
`Q9FFE9`	Arabidopsis thaliana	sp\|Q9FFE9\|AAE6_ARATH Probable acyl-activating enzyme 6	61.200%	Swiss-Prot	High
`Q9FFE6`	Arabidopsis thaliana	sp\|Q9FFE6\|AAE5_ARATH Probable acyl-activating enzyme 5, peroxisomal	61.300%	Swiss-Prot	High
`Q9LQS1`	Arabidopsis thaliana	sp\|Q9LQS1\|AAE8_ARATH Probable acyl-activating enzyme 8	58.500%	Swiss-Prot	High

JBrowse

View in Genome Browser

Gene Card