TkA02G451520 | RubberDandelionOmics

Gene overview

TkA02G451520

Reference: TK1151 Chr: Chr02 Coordinates: 114887951-114890369 Strand: - Type: protein_coding

cDNA / CDS / Protein Sequences

Available sequence downloads CDS FASTA Protein FASTA cDNA FASTA

cDNA

1464 bp · TkA02G451520|TK1151|cDNA

GTCTTAGAAAAACTCGAAAGGTCAAAAAGATGAATGCCAAACAGCCTCTAAATAACATCTCGATTGCTCCGATAAACGAGTGGAGATTTGAAGCAAGGTAAAGCAAGCCGACGATGGTTCAGGAAGAGAACAGTGGTGAGGCTGAAGCCATCCGTCCTCCATGGCTCCACCTACTTTCTGCATTTCTTTCTATGGAGCCCTCTAATTCCATATATCCATTTCCAGGGACTGCGGTGGAGGTGCAATCAAGGAGGTGTTCA...

CDS

Download CDS FASTA

348 bp · TkA02G451520|TK1151|CDS

ATGTGTCTGGCACAAGTGAAACCCTCCAAGGTGGTTTTAAGTGATGGTGATTTATCAACTTTAGCCAATTTGAAAGTCAACTTAGAGCTAAATCAGATGAATGCCAATGTCGAATGCTTACATCTACCATGGGAATCTGCACTTGAGAGTGATCTTCAAGATCTTAAGCCAGCAGATATAGTGTTGGGGGCAGATGTGATCTATGATCCGCAATGCATTACACATTTAGTTCGTGTGATTTCTGCTCTGTTGACCATAAA...

Protein

Download Protein FASTA

115 aa · TkA02G451520|TK1151|PROTEIN

MCLAQVKPSKVVLSDGDLSTLANLKVNLELNQMNANVECLHLPWESALESDLQDLKPADIVLGADVIYDPQCITHLVRVISALLTIKKSNSGQRDECFVASRDNRCIYRICGAEY

Flanking Sequence Download

Sequence orientation and download details

Upstream/downstream are capped at 10000 bp per side. Negative-strand genes are reverse-complemented so the final FASTA follows transcriptional 5′→3′ orientation.

ID Mapping

Input ID	`TkA02G451520`
TK1151 ID	TkA02G451520
OH-1004 ID	LXL04_014127
Relationship / confidence	Rbh Below Probable Coverage Or Synteny Threshold / Review
Protein identity (%)	94.400
Protein coverage (%)	TK1151 93.913 / OH-1004 29.888 Coverage and evidence Coverage is the aligned span of the best-scoring HSP divided by representative protein length. A homolog match does not establish functional validation.
Source version	TK1151 / GWHBCHF00000000

Open Full ID Mapping

SNP / Indel variants and carrier samplesCRA009020 · TK1151

Expand to load variant records for this gene.

Basic Information and Functional Annotation

Gene ID	`TkA02G451520`
Location	Chr02:114887951-114890369 (-)
Description	Similar to EEF2KMT: Protein-lysine N-methyltransferase EEF2KMT
Arabidopsis / Rice Reference Genes and Papers	Download references for this gene Arabidopsis No hit for this species in the current source table. Rice No hit for this species in the current source table.
Functional annotation source	View annotation sources Functional annotation source: OH1004 · `LXL04_014127` · GCA_047496595.1_OSU_TarKok_2.0. These OH1004 annotations are retrieved through ID mapping; the Arabidopsis/rice table below uses protein alignments from the query reference.
GO annotations (OH1004 source)	GO:0006479 protein methylation Biological Process GO:0018023 peptidyl-lysine trimethylation Biological Process GO:0032259 methylation Biological Process GO:0005737 cytoplasm Cellular Component GO:0005829 cytosol Cellular Component GO:0032991 protein-containing complex Cellular Component GO:0008276 protein methyltransferase activity Molecular Function GO:0016279 protein-lysine N-methyltransferase activity Molecular Function
KEGG gene cross-reference	bta:531984 ddi:DDB_G0276903 ddi:DDB_G0277003 hsa:196483 hsa:653333 hsa:85002 These KEGG gene identifiers are linked through homologous proteins; they do not establish pathway function for this gene.

Open Annotation Module

Gene expression

View expression in different studies, tissues and treatments. Results are presented separately by study and measurement unit.

View expression for this gene

Data sources and gene correspondence

Expression data come from public transcriptome studies. Reference genomes, sample metadata and measurement units are shown with the results. Ambiguous cross-reference correspondences do not select an expression record automatically; missing values do not mean zero expression.

Subcellular Localization Top 5

Computational predictions or homology annotations below do not replace localization experiments.

Cytoplasm0.604

Rank 1 · TkA02G451520 · TK1151

Nucleus0.432

Rank 2 · TkA02G451520 · TK1151

Mitochondrion0.073

Rank 3 · TkA02G451520 · TK1151

Endoplasmic reticulum0.064

Rank 4 · TkA02G451520 · TK1151

Cell membrane0.060

Rank 5 · TkA02G451520 · TK1151

LocPro · Direct prediction · Computational prediction, not experimental localization

Open Subcellular Module

Predicted Functional Domains

Domain results are from Pfam-A/HMMER; positions are amino-acid coordinates on the protein sequence.

PF10294Methyltransf_164-87 aa

Gene ID	Domain ID	Domain Name	Start aa	End aa	E-value	Score
TkA02G451520	`PF10294`	Methyltransf_16	4	87	8.6e-13	49.1

Arabidopsis / Rice Protein Homology

Only Arabidopsis and rice are shown. Swiss-Prot entries are reviewed; TrEMBL entries are supplementary sequence candidates. Similarity is not experimental validation.

Download current result

No result was found for this query.

JBrowse

View in Genome Browser

Gene Card