TkA02G451130 | RubberDandelionOmics

Gene overview

TkA02G451130

Reference: TK1151 Chr: Chr02 Coordinates: 114770402-114772179 Strand: + Type: protein_coding

cDNA / CDS / Protein Sequences

Available sequence downloads CDS FASTA Protein FASTA cDNA FASTA

cDNA

1648 bp · TkA02G451130|TK1151|cDNA

TATACCGCCACATGAATGATAAGAAAAATATAGTCAAGTTACAAGTAATTGATTATAACAGAATATGGATGAAAAAAGATGTCACATTGCAATGTACCCTTGGTTTGCTCTAGGCCACCTTACACCATACATGCACTTAGCCAATATGTTAGCCAAAAAGGGCCATAAAGTCTCCTTCTTGGTCCCTAAAAACACAAGATATAAACTTGATCCATTTAACCATCATCCACATCATATCACGTTTGTACCGATCACGGTTC...

CDS

Download CDS FASTA

1380 bp · TkA02G451130|TK1151|CDS

ATGGATGAAAAAAGATGTCACATTGCAATGTACCCTTGGTTTGCTCTAGGCCACCTTACACCATACATGCACTTAGCCAATATGTTAGCCAAAAAGGGCCATAAAGTCTCCTTCTTGGTCCCTAAAAACACAAGATATAAACTTGATCCATTTAACCATCATCCACATCATATCACGTTTGTACCGATCACGGTTCCACTTATTGGAGGTCTCCCTATGGGGGCTGAGACAAGTTTGGACGTGCCCGCTTCATTACACCC...

Protein

Download Protein FASTA

459 aa · TkA02G451130|TK1151|PROTEIN

MDEKRCHIAMYPWFALGHLTPYMHLANMLAKKGHKVSFLVPKNTRYKLDPFNHHPHHITFVPITVPLIGGLPMGAETSLDVPASLHPLIMTAMDETKESVEHILQDLMVDFVFFDMAHWIPSLCRRIRVKSVNYCVITPLFIGYIFSPARKVHWDKGISESDIMHPPAGFPLSSIKFHAHEARDFTARSNTTFGGQMSLVERVYIGLSQADVLAYNGSRELDGPFRDYLQTQFQKPVLLSGPIISDPPNDTLNQDLSNWL...

Flanking Sequence Download

Sequence orientation and download details

Upstream/downstream are capped at 10000 bp per side. Negative-strand genes are reverse-complemented so the final FASTA follows transcriptional 5′→3′ orientation.

ID Mapping

Input ID	`TkA02G451130`
TK1151 ID	TkA02G451130
OH-1004 ID	LXL04_014140
Relationship / confidence	Rbh High Identity Coverage Synteny / Strict
Protein identity (%)	99.600
Protein coverage (%)	TK1151 100.000 / OH-1004 100.000 Coverage and evidence Coverage is the aligned span of the best-scoring HSP divided by representative protein length. A homolog match does not establish functional validation.
Source version	TK1151 / GWHBCHF00000000

Open Full ID Mapping

SNP / Indel variants and carrier samplesCRA009020 · TK1151

Expand to load variant records for this gene.

Basic Information and Functional Annotation

Gene ID	`TkA02G451130`
Location	Chr02:114770402-114772179 (+)
Description	Similar to F3GGT1: Cyanidin 3-O-galactoside 2''-O-xylosyltransferase FGGT1
Arabidopsis / Rice Reference Genes and Papers	Download references for this gene Arabidopsis No hit for this species in the current source table. Rice No hit for this species in the current source table.
Functional annotation source	View annotation sources Functional annotation source: OH1004 · `LXL04_014140` · GCA_047496595.1_OSU_TarKok_2.0. These OH1004 annotations are retrieved through ID mapping; the Arabidopsis/rice table below uses protein alignments from the query reference.
GO annotations (OH1004 source)	GO:0009718 anthocyanin-containing compound biosynthetic process Biological Process GO:0043473 pigmentation Biological Process GO:0016758 hexosyltransferase activity Molecular Function GO:0033838 flavonol-3-O-glucoside glucosyltransferase activity Molecular Function GO:0035251 UDP-glucosyltransferase activity Molecular Function GO:0035252 UDP-xylosyltransferase activity Molecular Function GO:0102455 anthocyanidin 3-O-glucoside 2''-O-glucosyltransferase activity Molecular Function
KEGG gene cross-reference	ag:BAD95881 ag:BAD95882 gmx:100787444 ini:109188143 These KEGG gene identifiers are linked through homologous proteins; they do not establish pathway function for this gene.

Open Annotation Module

Gene expression

View expression in different studies, tissues and treatments. Results are presented separately by study and measurement unit.

View expression for this gene

Data sources and gene correspondence

Expression data come from public transcriptome studies. Reference genomes, sample metadata and measurement units are shown with the results. Ambiguous cross-reference correspondences do not select an expression record automatically; missing values do not mean zero expression.

Subcellular Localization Top 5

Computational predictions or homology annotations below do not replace localization experiments.

Cytoplasm0.822

Rank 1 · TkA02G451130 · TK1151

Nucleus0.228

Rank 2 · TkA02G451130 · TK1151

Peroxisome0.057

Rank 3 · TkA02G451130 · TK1151

Endoplasmic reticulum0.054

Rank 4 · TkA02G451130 · TK1151

Mitochondrion0.035

Rank 5 · TkA02G451130 · TK1151

LocPro · Direct prediction · Computational prediction, not experimental localization

Open Subcellular Module

Predicted Functional Domains

Domain results are from Pfam-A/HMMER; positions are amino-acid coordinates on the protein sequence.

PF26168Glyco_transf_N8-107 aa

PF03033Glyco_transf_2817-112 aa

PF26168Glyco_transf_N215-233 aa

PF00201UDPGT226-419 aa

PF03033Glyco_transf_28422-441 aa

Gene ID	Domain ID	Domain Name	Start aa	End aa	E-value	Score
TkA02G451130	`PF26168`	Glyco_transf_N	8	107	0.051	14.2
TkA02G451130	`PF03033`	Glyco_transf_28	17	112	0.00044	21.0
TkA02G451130	`PF26168`	Glyco_transf_N	215	233	0.051	14.2
TkA02G451130	`PF00201`	UDPGT	226	419	2.1e-11	44.0
TkA02G451130	`PF03033`	Glyco_transf_28	422	441	0.00044	21.0

Arabidopsis / Rice Protein Homology

Only Arabidopsis and rice are shown. Swiss-Prot entries are reviewed; TrEMBL entries are supplementary sequence candidates. Similarity is not experimental validation.

Download current result

No result was found for this query.

JBrowse

View in Genome Browser

Gene Card