TkA02G450900 | RubberDandelionOmics

Gene overview

TkA02G450900

Reference: TK1151 Chr: Chr02 Coordinates: 114700967-114703643 Strand: - Type: protein_coding

cDNA / CDS / Protein Sequences

Available sequence downloads CDS FASTA Protein FASTA cDNA FASTA

cDNA

1678 bp · TkA02G450900|TK1151|cDNA

CAAAAGTCATTTTTAGAAGCCAAGAGAAAGAGATCGTCACTTTTGCGAATTGCTTTCAGCTTTTAGTATGGCAATTGACTGAAATACCCTTACAGCCTCCTCTCTTTCGGTAGGTCGACGCACACGCACCCCTTTCTCGTTCATACTTCCATTGACTGGTTCTCACTCCAATCTTCACCTCGACGTCTCCACCGGATTCCACAGTGTAGACGAGCAACCTCAAAAGCAGATTTACAATATCAGAATCACCCTTTCATCCA...

CDS

Download CDS FASTA

954 bp · TkA02G450900|TK1151|CDS

ATGGGGGAAGTGATTTTAGGCATGCCAGGACCTTGGGCTGAAGATAATTCCGAAGCAGCTGATCATTATACAACCAAAATTGGTGGACTTCCAGACTGGCCTTTTCCCTTTCCTAATTCAATCATAAAACCTGATCTTCTTACATGTGATTCATGTGGAGAGGAACTCTGTCTTGTGGCTCAGATTTATGCTCCTATTTCCACCAAAACAGAAGAGCGTGTAATTTACATATTCACTTGCATTTCAACAGCCTGTGAAAC...

Protein

Download Protein FASTA

317 aa · TkA02G450900|TK1151|PROTEIN

MGEVILGMPGPWAEDNSEAADHYTTKIGGLPDWPFPFPNSIIKPDLLTCDSCGEELCLVAQIYAPISTKTEERVIYIFTCISTACETTRWRALRVQKSNNDNQSLDDPCASPSTTKLQDDDPWAFDDEQEDDGLDLDDLCRALTQATTLASASKTKKDPIHKDKPSPISITRPIDDKTPVNIKEKVIDGDDEVWEGETYEYDRAVNADRIYLKFKKRLDMYPDHCFRYSYGGGALLASSEVGDPGRCLVCGEIRQYEMQL...

Flanking Sequence Download

Sequence orientation and download details

Upstream/downstream are capped at 10000 bp per side. Negative-strand genes are reverse-complemented so the final FASTA follows transcriptional 5′→3′ orientation.

ID Mapping

Input ID	`TkA02G450900`
TK1151 ID	TkA02G450900
OH-1004 ID	LXL04_014145
Relationship / confidence	Rbh Below Probable Coverage Or Synteny Threshold / Review
Protein identity (%)	89.400
Protein coverage (%)	TK1151 100.000 / OH-1004 95.184 Coverage and evidence Coverage is the aligned span of the best-scoring HSP divided by representative protein length. A homolog match does not establish functional validation.
Source version	TK1151 / GWHBCHF00000000

Open Full ID Mapping

SNP / Indel variants and carrier samplesCRA009020 · TK1151

Expand to load variant records for this gene.

Basic Information and Functional Annotation

Gene ID	`TkA02G450900`
Location	Chr02:114700967-114703643 (-)
Description	Similar to PDCD2L: Programmed cell death protein 2-like
Arabidopsis / Rice Reference Genes and Papers	Download references for this gene Arabidopsis No hit for this species in the current source table. Rice No hit for this species in the current source table.
Functional annotation source	View annotation sources Functional annotation source: OH1004 · `LXL04_014145` · GCA_047496595.1_OSU_TarKok_2.0. These OH1004 annotations are retrieved through ID mapping; the Arabidopsis/rice table below uses protein alignments from the query reference.
GO annotations (OH1004 source)	GO:0012501 programmed cell death Biological Process GO:0030490 maturation of SSU-rRNA Biological Process GO:0042254 ribosome biogenesis Biological Process GO:0042274 ribosomal small subunit biogenesis Biological Process GO:0005634 nucleus Cellular Component GO:0005730 nucleolus Cellular Component GO:0005737 cytoplasm Cellular Component GO:0005829 cytosol Cellular Component GO:0016020 membrane Cellular Component GO:0008270 zinc ion binding Molecular Function GO:0140597 protein carrier chaperone Molecular Function
KEGG gene cross-reference	bta:512079 gga:415785 hsa:84306 mmu:68079 spo:2540619 These KEGG gene identifiers are linked through homologous proteins; they do not establish pathway function for this gene.

Open Annotation Module

Gene expression

View expression in different studies, tissues and treatments. Results are presented separately by study and measurement unit.

View expression for this gene

Data sources and gene correspondence

Expression data come from public transcriptome studies. Reference genomes, sample metadata and measurement units are shown with the results. Ambiguous cross-reference correspondences do not select an expression record automatically; missing values do not mean zero expression.

Subcellular Localization Top 5

Computational predictions or homology annotations below do not replace localization experiments.

Cytoplasm0.574

Rank 1 · TkA02G450900 · TK1151

Nucleus0.468

Rank 2 · TkA02G450900 · TK1151

Golgi apparatus0.065

Rank 3 · TkA02G450900 · TK1151

Cell membrane0.060

Rank 4 · TkA02G450900 · TK1151

Mitochondrion0.058

Rank 5 · TkA02G450900 · TK1151

LocPro · Direct prediction · Computational prediction, not experimental localization

Open Subcellular Module

Predicted Functional Domains

Domain results are from Pfam-A/HMMER; positions are amino-acid coordinates on the protein sequence.

PF30657PDCD2_N15-103 aa

PF04194PDCD2_C47-80 aa

PF04194PDCD2_C208-315 aa

PF30657PDCD2_N246-263 aa

Gene ID	Domain ID	Domain Name	Start aa	End aa	E-value	Score
TkA02G450900	`PF30657`	PDCD2_N	15	103	2.2e-13	51.2
TkA02G450900	`PF04194`	PDCD2_C	47	80	3e-25	89.1
TkA02G450900	`PF04194`	PDCD2_C	208	315	3e-25	89.1
TkA02G450900	`PF30657`	PDCD2_N	246	263	2.2e-13	51.2

Arabidopsis / Rice Protein Homology

Only Arabidopsis and rice are shown. Swiss-Prot entries are reviewed; TrEMBL entries are supplementary sequence candidates. Similarity is not experimental validation.

Download current result

No result was found for this query.

JBrowse

View in Genome Browser

Gene Card