TkA02G450140 | RubberDandelionOmics

Gene overview

TkA02G450140

Reference: TK1151 Chr: Chr02 Coordinates: 114501892-114504648 Strand: + Type: protein_coding

cDNA / CDS / Protein Sequences

Available sequence downloads CDS FASTA Protein FASTA cDNA FASTA

cDNA

2056 bp · TkA02G450140|TK1151|cDNA

CAAAGAAAAACTGGGTTTTTGACAATCAACTGACAGTAGATTTTTTTTTGTACGGCATCATTTTTTTTTGAACGGCATCAACTGACAGTAGATGCCTACTCCCTTACACGATCCTAGACTATATCGACGACAGTAGCACCAGTAATTTTAAGCGCAAGCAGATGAAAACCCACGGCGACGTGAATGCTCAATCGTTGTTCAATTCATTCCGACATGGGTTTAGAAGCCTTTCTCACAACGCTCACTGGGTTACTTCACCT...

CDS

Download CDS FASTA

1413 bp · TkA02G450140|TK1151|CDS

ATGAAAACCCACGGCGACGTGAATGCTCAATCGTTGTTCAATTCATTCCGACATGGGTTTAGAAGCCTTTCTCACAACGCTCACTGGGTTACTTCACCTGGATTCCAAATTTCTATTGCAAGTAGCATACTCAGTGTTGCTGGTTTGATTATCGCTTTCAGAGATGGCAGAGGAACAAGGGGTTTCAACAATTTATTGTTATCATGGTCGTCTTCGTCGGAGAACGAATCTTCGCCTGAGAAATTGTGGGCAGTGCCCGG...

Protein

Download Protein FASTA

470 aa · TkA02G450140|TK1151|PROTEIN

MKTHGDVNAQSLFNSFRHGFRSLSHNAHWVTSPGFQISIASSILSVAGLIIAFRDGRGTRGFNNLLLSWSSSSENESSPEKLWAVPGLQNLGNNCFLNVVLQALASCSSFLSSLQNIVEEVEASSEIEQIGDMPLAVSLNSLLQELCIIRHEGKVLSPRKVMLAMALYTPNFNLTSQQDAEEALAHMLSSLREECSTCFGSNQNSLALATGSSSRILVPNKRVIYSELERWTQSFLGPFNGIVGSILTCQSCSFQVECNQ...

Flanking Sequence Download

Sequence orientation and download details

Upstream/downstream are capped at 10000 bp per side. Negative-strand genes are reverse-complemented so the final FASTA follows transcriptional 5′→3′ orientation.

ID Mapping

Input ID	`TkA02G450140`
TK1151 ID	TkA02G450140
OH-1004 ID	LXL04_014152
Relationship / confidence	Rbh Below Probable Coverage Or Synteny Threshold / Review
Protein identity (%)	99.600
Protein coverage (%)	TK1151 54.681 / OH-1004 77.410 Coverage and evidence Coverage is the aligned span of the best-scoring HSP divided by representative protein length. A homolog match does not establish functional validation.
Source version	TK1151 / GWHBCHF00000000

Open Full ID Mapping

SNP / Indel variants and carrier samplesCRA009020 · TK1151

Expand to load variant records for this gene.

Basic Information and Functional Annotation

Gene ID TkA02G450140

Location Chr02:114501892-114504648 (+)

Description Similar to UBP27: Ubiquitin carboxyl-terminal hydrolase 27

Arabidopsis / Rice Reference Genes and Papers

Download references for this gene

Arabidopsis

Reference gene ID	Possible function	Papers / DOI
`At4g39370`	Recognizes and hydrolyzes the peptide bond at the C-terminal Gly of ubiquitin.	No verified direct reference in this release

Rice

No hit for this species in the current source table.

Functional annotation source

View annotation sources

Functional annotation source: OH1004 · LXL04_014152 · GCA_047496595.1_OSU_TarKok_2.0. These OH1004 annotations are retrieved through ID mapping; the Arabidopsis/rice table below uses protein alignments from the query reference.

GO annotations (OH1004 source)

GO:0000422 autophagy of mitochondrion Biological Process

GO:0006508 proteolysis Biological Process

GO:0007032 endosome organization Biological Process

GO:0007265 Ras protein signal transduction Biological Process

GO:0008053 mitochondrial fusion Biological Process

GO:0016579 protein deubiquitination Biological Process

GO:0031647 regulation of protein stability Biological Process

GO:0035871 protein K11-linked deubiquitination Biological Process

GO:0044313 protein K6-linked deubiquitination Biological Process

GO:0005634 nucleus Cellular Component

GO:0005737 cytoplasm Cellular Component

GO:0005739 mitochondrion Cellular Component

KEGG gene cross-reference

ath:AT1G32850

ath:AT4G39370

dme:Dmel_CG4165

dre:559099

xtr:733894

These KEGG gene identifiers are linked through homologous proteins; they do not establish pathway function for this gene.

Open Annotation Module

Gene expression

View expression in different studies, tissues and treatments. Results are presented separately by study and measurement unit.

View expression for this gene

Data sources and gene correspondence

Expression data come from public transcriptome studies. Reference genomes, sample metadata and measurement units are shown with the results. Ambiguous cross-reference correspondences do not select an expression record automatically; missing values do not mean zero expression.

Subcellular Localization Top 5

Computational predictions or homology annotations below do not replace localization experiments.

Mitochondrion0.391

Rank 1 · TkA02G450140 · TK1151

Cytoplasm0.238

Rank 2 · TkA02G450140 · TK1151

Nucleus0.224

Rank 3 · TkA02G450140 · TK1151

Peroxisome0.125

Rank 4 · TkA02G450140 · TK1151

Plastid0.070

Rank 5 · TkA02G450140 · TK1151

LocPro · Direct prediction · Computational prediction, not experimental localization

Open Subcellular Module

Predicted Functional Domains

Domain results are from Pfam-A/HMMER; positions are amino-acid coordinates on the protein sequence.

PF00443UCH87-464 aa

Gene ID	Domain ID	Domain Name	Start aa	End aa	E-value	Score
TkA02G450140	`PF00443`	UCH	87	464	3.2e-46	158.7

Arabidopsis / Rice Protein Homology

Only Arabidopsis and rice are shown. Swiss-Prot entries are reviewed; TrEMBL entries are supplementary sequence candidates. Similarity is not experimental validation.

Download current result

Protein	Organism	Description	Identity	Database	Confidence
`Q9FPS0`	Arabidopsis thaliana	sp\|Q9FPS0\|UBP27_ARATH Ubiquitin carboxyl-terminal hydrolase 27	36.600%	Swiss-Prot	Medium

JBrowse

View in Genome Browser

Gene Card