TkA02G449280 | RubberDandelionOmics

Gene overview

TkA02G449280

Reference: TK1151 Chr: Chr02 Coordinates: 114272410-114276038 Strand: - Type: protein_coding

cDNA / CDS / Protein Sequences

Available sequence downloads CDS FASTA Protein FASTA cDNA FASTA

cDNA

2125 bp · TkA02G449280|TK1151|cDNA

AGTTATCATGTCGATTGCATTTTAAAAATATCTCAATTCGTTACAAAAAAAGTAGAACTACCGACGTATTCTTTAGACGAATTTCAAGTTTCAACCTTTTTCCACTGCCGCGCATGACCGATGGAAAGTCCTCCACTTCCGCCTCTGCAGTCGTCATCTGAGGCCAACGTCGCCTCTACGACGAACCCTAACTCCGGTGGCTTGGATCAGAATGTCGAGAAACACTCTGAACAAAACTCCGGAACGAATGCGACCGCTAT...

CDS

Download CDS FASTA

1695 bp · TkA02G449280|TK1151|CDS

ATGGAAAGTCCTCCACTTCCGCCTCTGCAGTCGTCATCTGAGGCCAACGTCGCCTCTACGACGAACCCTAACTCCGGTGGCTTGGATCAGAATGTCGAGAAACACTCTGAACAAAACTCCGGAACGAATGCGACCGCTATCAAGAAAAAAATGAAGAAGAAAAAGAAGAAAAAGGACGTACAAAGATTCCGCTCCGACGTTTCTTTTGATCCACCTCAACAATCGTTGAATTCGTTTTCATCATCTTCCTCTACTTCTAG...

Protein

Download Protein FASTA

564 aa · TkA02G449280|TK1151|PROTEIN

MESPPLPPLQSSSEANVASTTNPNSGGLDQNVEKHSEQNSGTNATAIKKKMKKKKKKKDVQRFRSDVSFDPPQQSLNSFSSSSSTSSSLHPRSKGIRLYTNRRNPRSFSTPVSERHNGSEADALALPLGMSIAAFVAQVLEKKEATREKMSIHHLSQICSLAVKESLSNVFGNKFDSFVSNFERSFQSTLMTLRVINETSENTKISYQQMEETSTCDFHFNLKENMSTRQQQQEQSQSPIVSEYEEHVVSNQLAVLHDTR...

Flanking Sequence Download

Sequence orientation and download details

Upstream/downstream are capped at 10000 bp per side. Negative-strand genes are reverse-complemented so the final FASTA follows transcriptional 5′→3′ orientation.

ID Mapping

Input ID	`TkA02G449280`
TK1151 ID	TkA02G449280
OH-1004 ID	LXL04_014167
Relationship / confidence	Rbh High Identity Coverage Synteny / Strict
Protein identity (%)	99.500
Protein coverage (%)	TK1151 100.000 / OH-1004 100.000 Coverage and evidence Coverage is the aligned span of the best-scoring HSP divided by representative protein length. A homolog match does not establish functional validation.
Source version	TK1151 / GWHBCHF00000000

Open Full ID Mapping

SNP / Indel variants and carrier samplesCRA009020 · TK1151

Expand to load variant records for this gene.

Basic Information and Functional Annotation

Gene ID TkA02G449280

Location Chr02:114272410-114276038 (-)

Description Similar to CPR5: Protein CPR-5

Arabidopsis / Rice Reference Genes and Papers

Download references for this gene

Arabidopsis

Reference gene ID	Possible function	Papers / DOI
`At5g64930`	May play a role in transcriptional processes.	CPR5 is involved in cell proliferation and cell death control and encodes a novel transmembrane protein.2001 · DOI: 10.1016/s0960-9822(01)00590-5 Identification of a novel gene HYS1/CPR5 that has a repressive role in the induction of leaf senescence and pathogen-defence responses in Arabidopsis thaliana.2002 · DOI: 10.1046/j.0960-7412.2001.01228.x GeBP/GPL transcription factors regulate a subset of CPR5-dependent processes.2011 · DOI: 10.1104/pp.111.179804 A noncanonical role for the CKI-RB-E2F cell-cycle signaling pathway in plant effector-triggered immunity.2014 · DOI: 10.1016/j.chom.2014.10.005 The cpr5 mutant of Arabidopsis expresses both NPR1-dependent and NPR1-independent resistance.1997 · DOI: 10.1105/tpc.9.9.1573

Rice

No hit for this species in the current source table.

Functional annotation source

View annotation sources

Functional annotation source: OH1004 · LXL04_014167 · GCA_047496595.1_OSU_TarKok_2.0. These OH1004 annotations are retrieved through ID mapping; the Arabidopsis/rice table below uses protein alignments from the query reference.

GO annotations (OH1004 source)

GO:0006952 defense response Biological Process

GO:0009626 plant-type hypersensitive response Biological Process

GO:0009627 systemic acquired resistance Biological Process

GO:0009723 response to ethylene Biological Process

GO:0009868 jasmonic acid and ethylene-dependent systemic resistance, jasmonic acid mediated signaling pathway Biological Process

GO:0010090 trichome morphogenesis Biological Process

GO:0010150 leaf senescence Biological Process

GO:0010182 sugar mediated signaling pathway Biological Process

GO:0048573 photoperiodism, flowering Biological Process

GO:0051707 response to other organism Biological Process

GO:1900056 negative regulation of leaf senescence Biological Process

GO:0005634 nucleus Cellular Component

KEGG gene cross-reference

ath:AT5G64930

These KEGG gene identifiers are linked through homologous proteins; they do not establish pathway function for this gene.

Open Annotation Module

Gene expression

View expression in different studies, tissues and treatments. Results are presented separately by study and measurement unit.

View expression for this gene

Data sources and gene correspondence

Expression data come from public transcriptome studies. Reference genomes, sample metadata and measurement units are shown with the results. Ambiguous cross-reference correspondences do not select an expression record automatically; missing values do not mean zero expression.

Subcellular Localization Top 5

Computational predictions or homology annotations below do not replace localization experiments.

Nucleus0.407

Rank 1 · TkA02G449280 · TK1151

Endoplasmic reticulum0.340

Rank 2 · TkA02G449280 · TK1151

Cell membrane0.125

Rank 3 · TkA02G449280 · TK1151

Cytoplasm0.120

Rank 4 · TkA02G449280 · TK1151

Mitochondrion0.098

Rank 5 · TkA02G449280 · TK1151

LocPro · Direct prediction · Computational prediction, not experimental localization

Open Subcellular Module

Predicted Functional Domains

Domain results are from Pfam-A/HMMER; positions are amino-acid coordinates on the protein sequence.

PF11810DUF333221-101 aa

PF28583CPR5_C151-183 aa

PF11810DUF3332197-248 aa

PF11642Blo-t-5260-327 aa

PF28583CPR5_C277-554 aa

Gene ID	Domain ID	Domain Name	Start aa	End aa	E-value	Score
TkA02G449280	`PF11810`	DUF3332	21	101	7.1	7.0
TkA02G449280	`PF28583`	CPR5_C	151	183	8.8e-135	449.0
TkA02G449280	`PF11810`	DUF3332	197	248	7.1	7.0
TkA02G449280	`PF11642`	Blo-t-5	260	327	0.005	17.5
TkA02G449280	`PF28583`	CPR5_C	277	554	8.8e-135	449.0

Arabidopsis / Rice Protein Homology

Only Arabidopsis and rice are shown. Swiss-Prot entries are reviewed; TrEMBL entries are supplementary sequence candidates. Similarity is not experimental validation.

Download current result

Protein	Organism	Description	Identity	Database	Confidence
`Q9LV85`	Arabidopsis thaliana	sp\|Q9LV85\|CPR5_ARATH Protein CPR-5	38.100%	Swiss-Prot	Medium

JBrowse

View in Genome Browser

Gene Card