TkA02G444630 | RubberDandelionOmics

Gene overview

TkA02G444630

Reference: TK1151 Chr: Chr02 Coordinates: 112964160-112967318 Strand: + Type: protein_coding

cDNA / CDS / Protein Sequences

Available sequence downloads CDS FASTA Protein FASTA cDNA FASTA

cDNA

2177 bp · TkA02G444630|TK1151|cDNA

AGAACACAACTTGTTAAATTTAGCGAAGTGGTGTGCGGTGTGCCCTGCCATTTAGCCATATATACATACCCTTCTTTCTTGGCTAATCAGAGAAAGAAATGGAGAATATGAAATATGCCGAGGAGCTTGTGAGGGAATTTCTGTTCTTCAGAGGATTCACAACCACTTTGCAATCTTTCGAGAAAGAATTGGCCACAGATATTGGCAAAGGATTTCACAAGGATAAAATCTTTGACCTAATTTTTTCAGTATACATCCCT...

CDS

Download CDS FASTA

1884 bp · TkA02G444630|TK1151|CDS

ATGGAGAATATGAAATATGCCGAGGAGCTTGTGAGGGAATTTCTGTTCTTCAGAGGATTCACAACCACTTTGCAATCTTTCGAGAAAGAATTGGCCACAGATATTGGCAAAGGATTTCACAAGGATAAAATCTTTGACCTAATTTTTTCAGTATACATCCCTAAATTCCAGGCACAAAATCTAATTTCCTTGCTGACTTTTTTCAAACAATGTTTTTCGTCATCCGAAACCGTCTTGCTTGCTACCTTGTCCAAATTGGA...

Protein

Download Protein FASTA

627 aa · TkA02G444630|TK1151|PROTEIN

MENMKYAEELVREFLFFRGFTTTLQSFEKELATDIGKGFHKDKIFDLIFSVYIPKFQAQNLISLLTFFKQCFSSSETVLLATLSKLEISVLRYYIVHAVQSGRNDKIIEFFGVHGDDLLQRDHDWMSWFAIPYIKNPSLDPLFRVYFSREWFDSLQLSLRNFLSEILNGTRIPALLKISSEKHNVNNLKNDIKHLNTRLSQLQALLEEKEAQLRRSRSNVSTARQLSIGGNNESLCSTSETFSKESTVTTSNEAHSSTTN...

Flanking Sequence Download

Sequence orientation and download details

Upstream/downstream are capped at 10000 bp per side. Negative-strand genes are reverse-complemented so the final FASTA follows transcriptional 5′→3′ orientation.

ID Mapping

Input ID	`TkA02G444630`
TK1151 ID	TkA02G444630
OH-1004 ID	LXL04_014257
Relationship / confidence	Rbh Sequence Supported / Probable
Protein identity (%)	93.500
Protein coverage (%)	TK1151 100.000 / OH-1004 100.000 Coverage and evidence Coverage is the aligned span of the best-scoring HSP divided by representative protein length. A homolog match does not establish functional validation.
Source version	TK1151 / GWHBCHF00000000

Open Full ID Mapping

SNP / Indel variants and carrier samplesCRA009020 · TK1151

Expand to load variant records for this gene.

Basic Information and Functional Annotation

Gene ID	`TkA02G444630`
Location	Chr02:112964160-112967318 (+)
Description	Similar to wdr91: WD repeat-containing protein 91
Arabidopsis / Rice Reference Genes and Papers	Download references for this gene Arabidopsis No hit for this species in the current source table. Rice No hit for this species in the current source table.
Functional annotation source	View annotation sources Functional annotation source: OH1004 · `LXL04_014257` · GCA_047496595.1_OSU_TarKok_2.0. These OH1004 annotations are retrieved through ID mapping; the Arabidopsis/rice table below uses protein alignments from the query reference.
GO annotations (OH1004 source)	GO:0042176 regulation of protein catabolic process Biological Process GO:0045022 early endosome to late endosome transport Biological Process GO:0051898 negative regulation of phosphatidylinositol 3-kinase/protein kinase B signal transduction Biological Process GO:0005829 cytosol Cellular Component GO:0010008 endosome membrane Cellular Component GO:0031901 early endosome membrane Cellular Component GO:0031902 late endosome membrane Cellular Component GO:0035014 phosphatidylinositol 3-kinase regulator activity Molecular Function GO:0141039 phosphatidylinositol 3-kinase inhibitor activity Molecular Function
KEGG gene cross-reference	bta:540606 ddi:DDB_G0268084 dre:402898 These KEGG gene identifiers are linked through homologous proteins; they do not establish pathway function for this gene.

Open Annotation Module

Gene expression

View expression in different studies, tissues and treatments. Results are presented separately by study and measurement unit.

View expression for this gene

Data sources and gene correspondence

Expression data come from public transcriptome studies. Reference genomes, sample metadata and measurement units are shown with the results. Ambiguous cross-reference correspondences do not select an expression record automatically; missing values do not mean zero expression.

Subcellular Localization Top 5

Computational predictions or homology annotations below do not replace localization experiments.

Cytoplasm0.531

Rank 1 · TkA02G444630 · TK1151

Nucleus0.340

Rank 2 · TkA02G444630 · TK1151

Lysosome / Vacuole0.162

Rank 3 · TkA02G444630 · TK1151

Cell membrane0.109

Rank 4 · TkA02G444630 · TK1151

Golgi apparatus0.107

Rank 5 · TkA02G444630 · TK1151

LocPro · Direct prediction · Computational prediction, not experimental localization

Open Subcellular Module

Predicted Functional Domains

Domain results are from Pfam-A/HMMER; positions are amino-acid coordinates on the protein sequence.

PF26038Dimer_MINDY4_N6-32 aa

PF21051ARMC9_LisH10-31 aa

PF25391WD40_Gbeta44-125 aa

PF23138CTLH_Armc954-167 aa

PF23067MG280159-272 aa

PF29075NOCA1_mid176-240 aa

PF27720SSNA1177-212 aa

PF02601Exonuc_VII_L182-265 aa

Gene ID	Domain ID	Domain Name	Start aa	End aa	E-value	Score
TkA02G444630	`PF26038`	Dimer_MINDY4_N	6	32	9.4e-05	23.6
TkA02G444630	`PF21051`	ARMC9_LisH	10	31	0.0016	19.3
TkA02G444630	`PF25391`	WD40_Gbeta	44	125	1.1e-09	38.5
TkA02G444630	`PF23138`	CTLH_Armc9	54	167	5.9e-19	69.5
TkA02G444630	`PF23067`	MG280	159	272	0.35	11.1
TkA02G444630	`PF29075`	NOCA1_mid	176	240	0.023	15.3
TkA02G444630	`PF27720`	SSNA1	177	212	0.13	13.2
TkA02G444630	`PF02601`	Exonuc_VII_L	182	265	0.26	11.4
TkA02G444630	`PF16526`	CLZ	182	215	0.34	12.0
TkA02G444630	`PF28487`	WIP_coiled_coil	185	223	0.075	13.7
TkA02G444630	`PF23138`	CTLH_Armc9	189	216	5.9e-19	69.5
TkA02G444630	`PF24807`	WD40_CDC20-Fz	190	244	6.3e-20	72.4
TkA02G444630	`PF23409`	Beta-prop_EML	226	255	1.8e-11	44.8
TkA02G444630	`PF25391`	WD40_Gbeta	229	268	1.1e-09	38.5
TkA02G444630	`PF26038`	Dimer_MINDY4_N	250	273	9.4e-05	23.6
TkA02G444630	`PF24797`	Beta-prop_WDR35_TULP_N	298	399	0.027	14.3

Arabidopsis / Rice Protein Homology

Only Arabidopsis and rice are shown. Swiss-Prot entries are reviewed; TrEMBL entries are supplementary sequence candidates. Similarity is not experimental validation.

Download current result

No result was found for this query.

JBrowse

View in Genome Browser

Gene Card