TkA02G438340 | RubberDandelionOmics

Gene overview

TkA02G438340

Reference: TK1151 Chr: Chr02 Coordinates: 111354730-111356451 Strand: + Type: protein_coding

cDNA / CDS / Protein Sequences

Available sequence downloads CDS FASTA Protein FASTA cDNA FASTA

cDNA

588 bp · TkA02G438340|TK1151|cDNA

ATGGGGAAACCAGCCCCTGTTTCTAGCAAGGAGTCGAGCGCGGCCGCTAAAGACGACGATGAAGAATGGGATGATTTGGATTTGAGGGCGACAAGTGCTATTCGTTTGTCTCTTGCAAAGAATGTACTTGCAAATGTGCATGGGATATCAACGGCAAAAGAGTTGTGGGAGAAGCTTGAGAAGTTGTATCAAGGCAAAGGCATCTCGAATCGGTTGTATCTCAAGGAACAGTTTCATACTCTTCGTATGAATGGAGATAC...

CDS

Download CDS FASTA

588 bp · TkA02G438340|TK1151|CDS

ATGGGGAAACCAGCCCCTGTTTCTAGCAAGGAGTCGAGCGCGGCCGCTAAAGACGACGATGAAGAATGGGATGATTTGGATTTGAGGGCGACAAGTGCTATTCGTTTGTCTCTTGCAAAGAATGTACTTGCAAATGTGCATGGGATATCAACGGCAAAAGAGTTGTGGGAGAAGCTTGAGAAGTTGTATCAAGGCAAAGGCATCTCGAATCGGTTGTATCTCAAGGAACAGTTTCATACTCTTCGTATGAATGGAGATAC...

Protein

Download Protein FASTA

195 aa · TkA02G438340|TK1151|PROTEIN

MGKPAPVSSKESSAAAKDDDEEWDDLDLRATSAIRLSLAKNVLANVHGISTAKELWEKLEKLYQGKGISNRLYLKEQFHTLRMNGDTKISDHLSVLNNIVSELEAIGVKVEDEDKALRLILSLPSSYEHMKPILMYGKETLKYADVTGKLLSEEKRLESSGHTSSSEGMFLVWTIWACQKKLSRWSRFGKRLRYS

Flanking Sequence Download

Sequence orientation and download details

Upstream/downstream are capped at 10000 bp per side. Negative-strand genes are reverse-complemented so the final FASTA follows transcriptional 5′→3′ orientation.

ID Mapping

Input ID	`TkA02G438340`
TK1151 ID	TkA02G438340
OH-1004 ID	LXL04_004091
Relationship / confidence	Multi Candidate From Tk1151 / Complex relationship
Protein identity (%)	94.200
Protein coverage (%)	TK1151 88.205 / OH-1004 21.208 Coverage and evidence Coverage is the aligned span of the best-scoring HSP divided by representative protein length. A homolog match does not establish functional validation.
Source version	TK1151 / GWHBCHF00000000

Open Full ID Mapping

SNP / Indel variants and carrier samplesCRA009020 · TK1151

Expand to load variant records for this gene.

Basic Information and Functional Annotation

Gene ID	`TkA02G438340`
Location	Chr02:111354730-111356451 (+)
Description	Similar to KIN12A: Kinesin-like protein KIN-12A
Arabidopsis / Rice Reference Genes and Papers	Download references for this gene Arabidopsis No hit for this species in the current source table. Rice No hit for this species in the current source table.
Functional annotation source	View annotation sources Functional annotation source: OH1004 · `LXL04_004091` · GCA_047496595.1_OSU_TarKok_2.0. These OH1004 annotations are retrieved through ID mapping; the Arabidopsis/rice table below uses protein alignments from the query reference.
GO annotations (OH1004 source)	GO:0007018 microtubule-based movement Biological Process GO:0007112 male meiosis cytokinesis Biological Process GO:0055046 microgametogenesis Biological Process GO:0080175 phragmoplast microtubule organization Biological Process GO:0005737 cytoplasm Cellular Component GO:0005871 kinesin complex Cellular Component GO:0005874 microtubule Cellular Component GO:0009507 chloroplast Cellular Component GO:0009524 phragmoplast Cellular Component GO:0003777 microtubule motor activity Molecular Function GO:0005524 ATP binding Molecular Function GO:0008017 microtubule binding Molecular Function
KEGG gene cross-reference	ath:AT3G23670 ath:AT4G14150 These KEGG gene identifiers are linked through homologous proteins; they do not establish pathway function for this gene.

Open Annotation Module

Gene expression

View expression in different studies, tissues and treatments. Results are presented separately by study and measurement unit.

View expression for this gene

Data sources and gene correspondence

Expression data come from public transcriptome studies. Reference genomes, sample metadata and measurement units are shown with the results. Ambiguous cross-reference correspondences do not select an expression record automatically; missing values do not mean zero expression.

Subcellular Localization Top 5

Computational predictions or homology annotations below do not replace localization experiments.

Cytoplasm0.567

Rank 1 · TkA02G438340 · TK1151

Nucleus0.359

Rank 2 · TkA02G438340 · TK1151

Endoplasmic reticulum0.070

Rank 3 · TkA02G438340 · TK1151

Extracellular0.058

Rank 4 · TkA02G438340 · TK1151

Cell membrane0.046

Rank 5 · TkA02G438340 · TK1151

LocPro · Direct prediction · Computational prediction, not experimental localization

Open Subcellular Module

Predicted Functional Domains

Domain results are from Pfam-A/HMMER; positions are amino-acid coordinates on the protein sequence.

PF14223Retrotran_gag_213-160 aa

PF09969DUF220343-117 aa

PF28120Lmo085096-111 aa

Gene ID	Domain ID	Domain Name	Start aa	End aa	E-value	Score
TkA02G438340	`PF14223`	Retrotran_gag_2	13	160	1.6e-35	123.0
TkA02G438340	`PF09969`	DUF2203	43	117	0.15	13.5
TkA02G438340	`PF28120`	Lmo0850	96	111	0.2	11.9

Arabidopsis / Rice Protein Homology

Only Arabidopsis and rice are shown. Swiss-Prot entries are reviewed; TrEMBL entries are supplementary sequence candidates. Similarity is not experimental validation.

Download current result

No result was found for this query.

JBrowse

View in Genome Browser

Gene Card