TkA02G423400 | RubberDandelionOmics

Gene overview

TkA02G423400

Reference: TK1151 Chr: Chr02 Coordinates: 107536162-107539498 Strand: + Type: protein_coding

cDNA / CDS / Protein Sequences

Available sequence downloads CDS FASTA Protein FASTA cDNA FASTA

cDNA

1857 bp · TkA02G423400|TK1151|cDNA

TTGGTAGAACATCAGGCCCATTGATGCACTATTGAGGGAATCAATGTGAAAAGATTGGAAAAAAAGGAACAGGCGCGGTCTAAAAGGAAGGTCATGAGGAGGATAGATAGTGACATATAGGTATTAAAATTCTCCAGAGAGCTTAAAAAGAGCGCACTATCACACACAAGTCCAAACAATAAAAAGAAACAGCATGTGTCACCACAATTTCGAAATTAAAACAAAGCAACATGCGGATGGAAAAGAGCCCCCACCACTTC...

CDS

Download CDS FASTA

1122 bp · TkA02G423400|TK1151|CDS

ATGGGTAGCTGCTGGTGTAAATGGAAACCCTCCATATACAGAGTCTCATCCAACACGAAATCAGAGTTGACTAAGGATGGAAACTCTTTGGCGAGAAGAAAGGAGGAAGAAAACAAGCTGCCATCGAACCCTGAAGAAGTGGAAGATCTGCGTCGTAATTCTGCTACGAATCCATTGATGGTTTTCACATTTGATGAACTTAGAAGAATCACTGGTAATTTTAGGCAAGATCACATGCTTGGTGGAGGTGGATTTGGTAG...

Protein

Download Protein FASTA

373 aa · TkA02G423400|TK1151|PROTEIN

MGSCWCKWKPSIYRVSSNTKSELTKDGNSLARRKEEENKLPSNPEEVEDLRRNSATNPLMVFTFDELRRITGNFRQDHMLGGGGFGSVYKGFLEEDIKEGIPSIPVAVKVHDGDNSHQGHREWLAEVIFLGQLSHPNLVKLIGYCCEDEHRVLIYEYMARGSVENNLFSRVLLPLPWSTRMKIAIGAAKGLAFLHDAPKPVIYRDFKTSNILLDPDYNAKLSDFGLAKDGPVGDKTHVSTRIMGTYGYAAPEYIMTGHLT...

Flanking Sequence Download

Sequence orientation and download details

Upstream/downstream are capped at 10000 bp per side. Negative-strand genes are reverse-complemented so the final FASTA follows transcriptional 5′→3′ orientation.

ID Mapping

Input ID	`TkA02G423400`
TK1151 ID	TkA02G423400
OH-1004 ID	LXL04_000113
Relationship / confidence	Non Reciprocal Best Hit / Complex relationship
Protein identity (%)	67.200
Protein coverage (%)	TK1151 82.842 / OH-1004 72.960 Coverage and evidence Coverage is the aligned span of the best-scoring HSP divided by representative protein length. A homolog match does not establish functional validation.
Source version	TK1151 / GWHBCHF00000000

Open Full ID Mapping

SNP / Indel variants and carrier samplesCRA009020 · TK1151

Expand to load variant records for this gene.

Basic Information and Functional Annotation

Gene ID TkA02G423400

Location Chr02:107536162-107539498 (+)

Description Similar to PBL8: Probable serine/threonine-protein kinase PBL8

Arabidopsis / Rice Reference Genes and Papers

Download references for this gene

Arabidopsis

Reference gene ID	Possible function	Papers / DOI
`At5g56460`	May be involved in plant defense signaling.	No verified direct reference in this release
`At5g01020`	May be involved in plant defense signaling.	No verified direct reference in this release

Rice

No hit for this species in the current source table.

Functional annotation source

View annotation sources

Functional annotation source: OH1004 · LXL04_000113 · GCA_047496595.1_OSU_TarKok_2.0. These OH1004 annotations are retrieved through ID mapping; the Arabidopsis/rice table below uses protein alignments from the query reference.

GO annotations (OH1004 source)

GO:0002238 response to molecule of fungal origin Biological Process

GO:0006468 protein phosphorylation Biological Process

GO:0006952 defense response Biological Process

GO:0012501 programmed cell death Biological Process

GO:0032491 detection of molecule of fungal origin Biological Process

GO:0042742 defense response to bacterium Biological Process

GO:0050832 defense response to fungus Biological Process

GO:0062207 regulation of pattern recognition receptor signaling pathway Biological Process

GO:1903428 positive regulation of reactive oxygen species biosynthetic process Biological Process

GO:0005739 mitochondrion Cellular Component

GO:0005886 plasma membrane Cellular Component

GO:0009506 plasmodesma Cellular Component

KEGG gene cross-reference

ath:AT2G05940

ath:AT2G07180

ath:AT5G01020

ath:AT5G56460

These KEGG gene identifiers are linked through homologous proteins; they do not establish pathway function for this gene.

Open Annotation Module

Gene expression

View expression in different studies, tissues and treatments. Results are presented separately by study and measurement unit.

View expression for this gene

Data sources and gene correspondence

Expression data come from public transcriptome studies. Reference genomes, sample metadata and measurement units are shown with the results. Ambiguous cross-reference correspondences do not select an expression record automatically; missing values do not mean zero expression.

Subcellular Localization Top 5

Computational predictions or homology annotations below do not replace localization experiments.

Cell membrane0.728

Rank 1 · TkA02G423400 · TK1151

Cytoplasm0.213

Rank 2 · TkA02G423400 · TK1151

Nucleus0.200

Rank 3 · TkA02G423400 · TK1151

Endoplasmic reticulum0.041

Rank 4 · TkA02G423400 · TK1151

Golgi apparatus0.026

Rank 5 · TkA02G423400 · TK1151

LocPro · Direct prediction · Computational prediction, not experimental localization

Open Subcellular Module

Predicted Functional Domains

Domain results are from Pfam-A/HMMER; positions are amino-acid coordinates on the protein sequence.

PF00069Pkinase75-349 aa

PF07714PK_Tyr_Ser-Thr76-351 aa

PF17830STI1-HOP_DP207-224 aa

PF24192DUF7417243-274 aa

PF17830STI1-HOP_DP334-346 aa

Gene ID	Domain ID	Domain Name	Start aa	End aa	E-value	Score
TkA02G423400	`PF00069`	Pkinase	75	349	2.1e-41	142.8
TkA02G423400	`PF07714`	PK_Tyr_Ser-Thr	76	351	6.9e-45	154.1
TkA02G423400	`PF17830`	STI1-HOP_DP	207	224	0.17	12.5
TkA02G423400	`PF24192`	DUF7417	243	274	0.19	12.2
TkA02G423400	`PF17830`	STI1-HOP_DP	334	346	0.17	12.5

Arabidopsis / Rice Protein Homology

Only Arabidopsis and rice are shown. Swiss-Prot entries are reviewed; TrEMBL entries are supplementary sequence candidates. Similarity is not experimental validation.

Download current result

Protein	Organism	Description	Identity	Database	Confidence
`Q9FM85`	Arabidopsis thaliana	sp\|Q9FM85\|PBL16_ARATH Probable serine/threonine-protein kinase PBL16	78.800%	Swiss-Prot	High
`Q8GXZ3`	Arabidopsis thaliana	sp\|Q8GXZ3\|PBL8_ARATH Probable serine/threonine-protein kinase PBL8	58.500%	Swiss-Prot	High

JBrowse

View in Genome Browser

Gene Card