RubberDandelionOmics Rubber Dandelion Multi-omics Website
More
Transcriptome Expression Annotation Rubber Pathway TF Prediction Targets Protein Network Resequencing Tools Downloads
ZH EN

How to use this page

Gene Card

Enter a TK1151 or OH-1004 gene ID to view sequences, annotations and analyses in the corresponding reference genome.
Flanking length, max 10000 bp
Examples TkA01G624900 LXL04_000258

Gene overview

TkA02G422860
Reference: TK1151 Chr: Chr02 Coordinates: 107364200-107368427 Strand: - Type: protein_coding

cDNA / CDS / Protein Sequences

Available sequence downloads CDS FASTA Protein FASTA cDNA FASTA

cDNA

Download cDNA FASTA

2441 bp · TkA02G422860|TK1151|cDNA

AAAGGTTGGTACTTGGGAGCCCTGTGATCCAAACGGCGTCGTTAATTTGGTCGAACTTAAACCCCCGTCTATCAGTACCACCACTGCAATTACAGTCTCTTGTGTATCGCTGCTACTAGGGATTCAAATGCGCGACCAAATGATCCGAGGATCGCATTGAATAATCGGTGCTGCTTTTCATATCTTTCGAGTTCAGCTGCTGTGGATTTTGAGATAAAGCCACGAAAAATCCGTTGCACAAAGGTCTAACTTAGTAAGAA...

CDS

Download CDS FASTA

1830 bp · TkA02G422860|TK1151|CDS

ATGAAAATGAAGATACATACACAATCCCTCCTACCTTTCGTCTGTTGCGCGATTTTGGTTCTCAGATCTGCCCTTGTTTCATCAGAAAACCTTCTCGGAGTTGCTCCGCAAGATAAGGAACACTACAAGGGTTTATCTTCGTCAGGAACGATTAAATGCAAAGACGGATCTAAAACATTCACAAAGTTACAACTTAATGACGACTTTTGTGATTGCTCTGATGGCACCGATGAACCAGGAACATCAGCATGTCCTACTGG...

Protein

Download Protein FASTA

609 aa · TkA02G422860|TK1151|PROTEIN

MKMKIHTQSLLPFVCCAILVLRSALVSSENLLGVAPQDKEHYKGLSSSGTIKCKDGSKTFTKLQLNDDFCDCSDGTDEPGTSACPTGKFYCQNLGHSPLSIFSSRVNDGICDCCDGSDEYNGKIKCKNTCWEAGKVARDRLKKKIATFQEGVVIRKREVEEAKVSLAKDEAELSRLKNEESILKGLVQQLKDRKDQIEKEEEKERLQKEKEKKEAEEARLKEQKSEETVQESKESSSDNDNAAKIHDESPSDEDINKDHE...

Flanking Sequence Download

Sequence orientation and download details

Upstream/downstream are capped at 10000 bp per side. Negative-strand genes are reverse-complemented so the final FASTA follows transcriptional 5′→3′ orientation.

Download Gene (CDS) Download Protein

ID Mapping

Input IDTkA02G422860
TK1151 IDTkA02G422860
OH-1004 IDLXL04_014477
Relationship / confidenceRbh Sequence Supported / Probable
Protein identity (%)91.700
Protein coverage (%)TK1151 100.000 / OH-1004 100.000
Coverage and evidence

Coverage is the aligned span of the best-scoring HSP divided by representative protein length. A homolog match does not establish functional validation.

Source versionTK1151 / GWHBCHF00000000
Open Full ID Mapping
SNP / Indel variants and carrier samplesCRA009020 · TK1151

Expand to load variant records for this gene.

Basic Information and Functional Annotation

Gene IDTkA02G422860
LocationChr02:107364200-107368427 (-)
DescriptionSimilar to OsI_01383: Glucosidase 2 subunit beta
Arabidopsis / Rice Reference Genes and Papers

Download references for this gene

Arabidopsis

Reference gene IDPossible functionPapers / DOI
At5g56360 Regulatory subunit of glucosidase II (By similarity).
Uncoupling of sustained MAMP receptor signaling from early outputs in an Arabidopsis endoplasmic reticulum glucosidase II allele.2009 · DOI: 10.1073/pnas.0907711106

Rice

Reference gene IDPossible functionPapers / DOI
UniProt: A2WNF5 Regulatory subunit of glucosidase II. No verified direct reference in this release
Os01g0276800 Regulatory subunit of glucosidase II. No verified direct reference in this release
Functional annotation source
View annotation sources

Functional annotation source: OH1004 · LXL04_014477 · GCA_047496595.1_OSU_TarKok_2.0. These OH1004 annotations are retrieved through ID mapping; the Arabidopsis/rice table below uses protein alignments from the query reference.

GO annotations (OH1004 source)
GO:0006491 N-glycan processing Biological Process
GO:0006952 defense response Biological Process
GO:0042742 defense response to bacterium Biological Process
GO:0071941 nitrogen cycle metabolic process Biological Process
GO:0005783 endoplasmic reticulum Cellular Component
GO:0009507 chloroplast Cellular Component
GO:0009536 plastid Cellular Component
GO:0017177 glucosidase II complex Cellular Component
GO:0043231 intracellular membrane-bounded organelle Cellular Component
GO:0003723 RNA binding Molecular Function
GO:0005080 protein kinase C binding Molecular Function
GO:0005509 calcium ion binding Molecular Function
KEGG gene cross-reference
ath:AT5G56360
dosa:Os01g0276800
mmu:19089
These KEGG gene identifiers are linked through homologous proteins; they do not establish pathway function for this gene.
Open Annotation Module

Gene expression

View expression in different studies, tissues and treatments. Results are presented separately by study and measurement unit.

View expression for this gene
Data sources and gene correspondence

Expression data come from public transcriptome studies. Reference genomes, sample metadata and measurement units are shown with the results. Ambiguous cross-reference correspondences do not select an expression record automatically; missing values do not mean zero expression.

Subcellular Localization Top 5

Computational predictions or homology annotations below do not replace localization experiments.

Endoplasmic reticulum0.770
Rank 1 · TkA02G422860 · TK1151
Cytoplasm0.146
Rank 2 · TkA02G422860 · TK1151
Golgi apparatus0.139
Rank 3 · TkA02G422860 · TK1151
Nucleus0.121
Rank 4 · TkA02G422860 · TK1151
Cell membrane0.067
Rank 5 · TkA02G422860 · TK1151

LocPro · Direct prediction · Computational prediction, not experimental localization

Open Subcellular Module

Predicted Functional Domains

Domain results are from Pfam-A/HMMER; positions are amino-acid coordinates on the protein sequence.

PF12999PRKCSH-like27-173 aa
PF27837Fyv8153-458 aa
PF29507SEG2169-449 aa
PF12999PRKCSH-like192-213 aa
PF13015PRKCSH_1207-216 aa
PF07915PRKCSH214-216 aa
PF12999PRKCSH-like271-297 aa
PF13015PRKCSH_1303-336 aa
Gene IDDomain IDDomain NameStart aaEnd aaE-valueScore
TkA02G422860PF12999PRKCSH-like271734.6e-37128.2
TkA02G422860PF27837Fyv81534580.008215.4
TkA02G422860PF29507SEG21694499.26.0
TkA02G422860PF12999PRKCSH-like1922134.6e-37128.2
TkA02G422860PF13015PRKCSH_12072166.7e-2794.8
TkA02G422860PF07915PRKCSH2142165.3e-0834.3
TkA02G422860PF12999PRKCSH-like2712974.6e-37128.2
TkA02G422860PF13015PRKCSH_13033366.7e-2794.8
TkA02G422860PF07915PRKCSH3243525.3e-0834.3
TkA02G422860PF13015PRKCSH_13794006.7e-2794.8
TkA02G422860PF12999PRKCSH-like4244374.6e-37128.2
TkA02G422860PF13015PRKCSH_14515936.7e-2794.8
TkA02G422860PF07915PRKCSH4905425.3e-0834.3

Arabidopsis / Rice Protein Homology

Only Arabidopsis and rice are shown. Swiss-Prot entries are reviewed; TrEMBL entries are supplementary sequence candidates. Similarity is not experimental validation.

Download current result

ProteinOrganismDescriptionIdentityDatabaseConfidence
Q9FM96Arabidopsis thalianasp|Q9FM96|PSL4_ARATH Glucosidase 2 subunit beta48.600%Swiss-ProtMedium
A2WNF5Oryza sativa subsp. indicasp|A2WNF5|GLU2B_ORYSI Glucosidase 2 subunit beta52.400%Swiss-ProtHigh
Q5NBP9Oryza sativa subsp. japonicasp|Q5NBP9|GLU2B_ORYSJ Glucosidase 2 subunit beta52.300%Swiss-ProtHigh

JBrowse

View in Genome Browser