TkA02G406340 | RubberDandelionOmics

Gene overview

TkA02G406340

Reference: TK1151 Chr: Chr02 Coordinates: 103301028-103304786 Strand: + Type: protein_coding

cDNA / CDS / Protein Sequences

Available sequence downloads CDS FASTA Protein FASTA cDNA FASTA

cDNA

1609 bp · TkA02G406340|TK1151|cDNA

TTGTCGATAGAAGGATCAATAGCCAGATGAAAACCTTCACTAAAAGAATTTCGAACTCAAATGCCTAGCAGTTGAAAATGGTTTGCTGTCAGTTCTCAAATCATCTACTTAACAACGTTTGCAGAACTCTTTACTGCTGCGGAAGGAGCTTTTCAGCGAATCACAGGGCTAGAACGTCTCGTAATCTCTTTTCTTCTTCACGTATACGATTTGCCAAGGGTTACCACAAAGTGTCAAATTCTTTGAAGGCAGAACTATCT...

CDS

Download CDS FASTA

1251 bp · TkA02G406340|TK1151|CDS

ATGGTTTGCTGTCAGTTCTCAAATCATCTACTTAACAACGTTTGCAGAACTCTTTACTGCTGCGGAAGGAGCTTTTCAGCGAATCACAGGGCTAGAACGTCTCGTAATCTCTTTTCTTCTTCACGTATACGATTTGCCAAGGGTTACCACAAAGTGTCAAATTCTTTGAAGGCAGAACTATCTAAAACCACTCCTGTTGCTTCTATTAAAGAATCGGAAAGTGTTGAAAAAGAAGCAACACCATCAGAAAGCACCTCCTT...

Protein

Download Protein FASTA

416 aa · TkA02G406340|TK1151|PROTEIN

MVCCQFSNHLLNNVCRTLYCCGRSFSANHRARTSRNLFSSSRIRFAKGYHKVSNSLKAELSKTTPVASIKESESVEKEATPSESTSFDSSQKTDNVVNVDSSNGRVMLIDGTSIIYRSYYKLLAKLHHGHLSNADGNGDWVLTISTALSLIIDVLEFTPSHVAVVFDHDGQTFRHTMYPSYKSNRPPTPDTIVQGLQYLKASIKAMSIKVIEVPGVEADDVIGTLAIRSVQDGFKVRVVSPDKDFFQILSPSLRLLRIAP...

Flanking Sequence Download

Sequence orientation and download details

Upstream/downstream are capped at 10000 bp per side. Negative-strand genes are reverse-complemented so the final FASTA follows transcriptional 5′→3′ orientation.

ID Mapping

Input ID	`TkA02G406340`
TK1151 ID	TkA02G406340
OH-1004 ID	LXL04_014655
Relationship / confidence	Rbh Sequence Supported / Probable
Protein identity (%)	93.100
Protein coverage (%)	TK1151 100.000 / OH-1004 100.000 Coverage and evidence Coverage is the aligned span of the best-scoring HSP divided by representative protein length. A homolog match does not establish functional validation.
Source version	TK1151 / GWHBCHF00000000

Open Full ID Mapping

SNP / Indel variants and carrier samplesCRA009020 · TK1151

Expand to load variant records for this gene.

Basic Information and Functional Annotation

Gene ID	`TkA02G406340`
Location	Chr02:103301028-103304786 (+)
Description	Similar to polA: DNA polymerase I
Arabidopsis / Rice Reference Genes and Papers	Download references for this gene Arabidopsis No hit for this species in the current source table. Rice No hit for this species in the current source table.
Functional annotation source	View annotation sources Functional annotation source: OH1004 · `LXL04_014655` · GCA_047496595.1_OSU_TarKok_2.0. These OH1004 annotations are retrieved through ID mapping; the Arabidopsis/rice table below uses protein alignments from the query reference.
GO annotations (OH1004 source)	GO:0006261 DNA-templated DNA replication Biological Process GO:0006302 double-strand break repair Biological Process GO:0001882 nucleoside binding Molecular Function GO:0003677 DNA binding Molecular Function GO:0003887 DNA-directed DNA polymerase activity Molecular Function GO:0008408 3'-5' exonuclease activity Molecular Function GO:0008409 5'-3' exonuclease activity Molecular Function
KEGG gene cross-reference	spr:spr0032 ttj:TTHA1054 These KEGG gene identifiers are linked through homologous proteins; they do not establish pathway function for this gene.

Open Annotation Module

Gene expression

View expression in different studies, tissues and treatments. Results are presented separately by study and measurement unit.

View expression for this gene

Data sources and gene correspondence

Expression data come from public transcriptome studies. Reference genomes, sample metadata and measurement units are shown with the results. Ambiguous cross-reference correspondences do not select an expression record automatically; missing values do not mean zero expression.

Subcellular Localization Top 5

Computational predictions or homology annotations below do not replace localization experiments.

Plastid0.669

Rank 1 · TkA02G406340 · TK1151

Mitochondrion0.282

Rank 2 · TkA02G406340 · TK1151

Nucleus0.064

Rank 3 · TkA02G406340 · TK1151

Cytoplasm0.035

Rank 4 · TkA02G406340 · TK1151

Cell membrane0.009

Rank 5 · TkA02G406340 · TK1151

LocPro · Direct prediction · Computational prediction, not experimental localization

Open Subcellular Module

Predicted Functional Domains

Domain results are from Pfam-A/HMMER; positions are amino-acid coordinates on the protein sequence.

PF027395_3_exonuc_N106-278 aa

PF013675_3_exonuc280-377 aa

Gene ID	Domain ID	Domain Name	Start aa	End aa	E-value	Score
TkA02G406340	`PF02739`	5_3_exonuc_N	106	278	4.5e-44	150.8
TkA02G406340	`PF01367`	5_3_exonuc	280	377	7.9e-28	97.5

Arabidopsis / Rice Protein Homology

Only Arabidopsis and rice are shown. Swiss-Prot entries are reviewed; TrEMBL entries are supplementary sequence candidates. Similarity is not experimental validation.

Download current result

No result was found for this query.

JBrowse

View in Genome Browser

Gene Card