TkA02G401030 | RubberDandelionOmics

Gene overview

TkA02G401030

Reference: TK1151 Chr: Chr02 Coordinates: 101838411-101839759 Strand: - Type: protein_coding

cDNA / CDS / Protein Sequences

Available sequence downloads CDS FASTA Protein FASTA cDNA FASTA

cDNA

504 bp · TkA02G401030|TK1151|cDNA

ATGGCTGCAGTGAAGAATTTCCCAGGCATTGTGATTGCAGAGGAGGCCCAATGGAAAGAGTGCATTGAAGGGTCAACTGGAGTTGTGAACTTGGCTGGGTTGCCCATTAGTACAAGATGGTCTCCTGAGGTGAAGAAAGAGATCAAAGAAAGCAGGGTCAGAGTCACCTCAAAGAGTGCTATTATTTTTGTTGTAGCTTCATCCACCAACAAAGAAGACACAAAATTTAAAAGGTTTTGGATTCAAAGTAATCCAAGAAA...

CDS

Download CDS FASTA

504 bp · TkA02G401030|TK1151|CDS

ATGGCTGCAGTGAAGAATTTCCCAGGCATTGTGATTGCAGAGGAGGCCCAATGGAAAGAGTGCATTGAAGGGTCAACTGGAGTTGTGAACTTGGCTGGGTTGCCCATTAGTACAAGATGGTCTCCTGAGGTGAAGAAAGAGATCAAAGAAAGCAGGGTCAGAGTCACCTCAAAGAGTGCTATTATTTTTGTTGTAGCTTCATCCACCAACAAAGAAGACACAAAATTTAAAAGGTTTTGGATTCAAAGTAATCCAAGAAA...

Protein

Download Protein FASTA

167 aa · TkA02G401030|TK1151|PROTEIN

MAAVKNFPGIVIAEEAQWKECIEGSTGVVNLAGLPISTRWSPEVKKEIKESRVRVTSKSAIIFVVASSTNKEDTKFKRFWIQSNPRKCSSGEDVQVVENGDVEMSKFKDGNHMFYYGSVTTEFTTESLLRILQRKDSYGFYNGSVPTDFATEYIGYGIKSVAALQRK

Flanking Sequence Download

Sequence orientation and download details

Upstream/downstream are capped at 10000 bp per side. Negative-strand genes are reverse-complemented so the final FASTA follows transcriptional 5′→3′ orientation.

ID Mapping

Input ID	`TkA02G401030`
TK1151 ID	TkA02G401030
OH-1004 ID	LXL04_034002
Relationship / confidence	Sequence Supported Annotation Or Model Conflict / Review
Protein identity (%)	97.500
Protein coverage (%)	TK1151 96.407 / OH-1004 43.048 Coverage and evidence Coverage is the aligned span of the best-scoring HSP divided by representative protein length. A homolog match does not establish functional validation.
Source version	TK1151 / GWHBCHF00000000

Open Full ID Mapping

SNP / Indel variants and carrier samplesCRA009020 · TK1151

Expand to load variant records for this gene.

Basic Information and Functional Annotation

Gene ID TkA02G401030

Location Chr02:101838411-101839759 (-)

Description Similar to GC1: Epimerase family protein SDR39U1 homolog, chloroplastic

Arabidopsis / Rice Reference Genes and Papers

Download references for this gene

Arabidopsis

Reference gene ID	Possible function	Papers / DOI
`At2g21280`	Putative NADP-dependent oxidoreductase that acts as a positive regulator of chloroplast division.	GIANT CHLOROPLAST 1 is essential for correct plastid division in Arabidopsis.2004 · DOI: 10.1016/j.cub.2004.04.031

Rice

No hit for this species in the current source table.

Functional annotation source

View annotation sources

Functional annotation source: OH1004 · LXL04_034002 · GCA_047496595.1_OSU_TarKok_2.0. These OH1004 annotations are retrieved through ID mapping; the Arabidopsis/rice table below uses protein alignments from the query reference.

GO annotations (OH1004 source)

GO:0007165 signal transduction Biological Process

GO:0010020 chloroplast fission Biological Process

GO:0005576 extracellular region Cellular Component

GO:0005886 plasma membrane Cellular Component

GO:0009507 chloroplast Cellular Component

GO:0009536 plastid Cellular Component

GO:0009706 chloroplast inner membrane Cellular Component

GO:0009941 chloroplast envelope Cellular Component

GO:0016491 oxidoreductase activity Molecular Function

GO:0042803 protein homodimerization activity Molecular Function

KEGG gene cross-reference

ath:AT2G21280

ath:AT3G49750

ath:AT5G65830

ecj:JW2301

eco:b2304

ecoc:C3026_12850

syn:slr1223

These KEGG gene identifiers are linked through homologous proteins; they do not establish pathway function for this gene.

Open Annotation Module

Gene expression

View expression in different studies, tissues and treatments. Results are presented separately by study and measurement unit.

View expression for this gene

Data sources and gene correspondence

Expression data come from public transcriptome studies. Reference genomes, sample metadata and measurement units are shown with the results. Ambiguous cross-reference correspondences do not select an expression record automatically; missing values do not mean zero expression.

Subcellular Localization Top 5

Computational predictions or homology annotations below do not replace localization experiments.

Cytoplasm0.491

Rank 1 · TkA02G401030 · TK1151

Nucleus0.337

Rank 2 · TkA02G401030 · TK1151

Mitochondrion0.125

Rank 3 · TkA02G401030 · TK1151

Cell membrane0.093

Rank 4 · TkA02G401030 · TK1151

Extracellular0.073

Rank 5 · TkA02G401030 · TK1151

LocPro · Direct prediction · Computational prediction, not experimental localization

Open Subcellular Module

Predicted Functional Domains

No result was found for this query.

Arabidopsis / Rice Protein Homology

Only Arabidopsis and rice are shown. Swiss-Prot entries are reviewed; TrEMBL entries are supplementary sequence candidates. Similarity is not experimental validation.

Download current result

Protein	Organism	Description	Identity	Database	Confidence
`Q9SJU9`	Arabidopsis thaliana	sp\|Q9SJU9\|GC1_ARATH Epimerase family protein SDR39U1 homolog, chloroplastic	81.500%	Swiss-Prot	Low

JBrowse

View in Genome Browser

Gene Card