TkA02G391960 | RubberDandelionOmics

Gene overview

TkA02G391960

Reference: TK1151 Chr: Chr02 Coordinates: 99612738-99614859 Strand: + Type: protein_coding

cDNA / CDS / Protein Sequences

Available sequence downloads CDS FASTA Protein FASTA cDNA FASTA

cDNA

1692 bp · TkA02G391960|TK1151|cDNA

AAAAGCCATCAAAAAAGGGTACATGTCATAAAAGAAAACTTAAAGCATAACACAAAAGTAAAGAATATGCATCACGAATATTGCAAATCAACACCACTTTTTGTAATTCATCTTCAACCATTCTTCACAAACACAAACAAATCCGACATTAATTCCTCAAAAAAAATTCGAATATTGATGGAGAGCGCAGGATCAAGAGAGTTGATCAAGTCAATCTTGATCATTGCTGGAATCCCTCTTGCTTTTTCTTTAATTGCTAG...

CDS

Download CDS FASTA

1257 bp · TkA02G391960|TK1151|CDS

ATGCATCACGAATATTGCAAATCAACACCACTTTTTGTAATTCATCTTCAACCATTCTTCACAAACACAAACAAATCCGACATTAATTCCTCAAAAAAAATTCGAATATTGATGGAGAGCGCAGGATCAAGAGAGTTGATCAAGTCAATCTTGATCATTGCTGGAATCCCTCTTGCTTTTTCTTTAATTGCTAGGATAACAAATCGAAAGATTTCATCTTCCCAATATCAAATACAAGAAACCGAATCTGATAGGAATCA...

Protein

Download Protein FASTA

418 aa · TkA02G391960|TK1151|PROTEIN

MHHEYCKSTPLFVIHLQPFFTNTNKSDINSSKKIRILMESAGSRELIKSILIIAGIPLAFSLIARITNRKISSSQYQIQETESDRNHLKDQILTLRTKIEELQKLEREIEDRFFRFINLKDQEYALMEVHNNLAIEKERADFLEMKVSSVEVETKKFDEMVIEYLKTLQELEISRTENGLLRRTIKTLLKKTRESLKLAREQNLKIEEREAEMLRIQVELKRKESAIESFEREVDDIRAMISQLQDEKNELSSKLDNAET...

Flanking Sequence Download

Sequence orientation and download details

Upstream/downstream are capped at 10000 bp per side. Negative-strand genes are reverse-complemented so the final FASTA follows transcriptional 5′→3′ orientation.

ID Mapping

Input ID	`TkA02G391960`
TK1151 ID	TkA02G391960
OH-1004 ID	LXL04_021409
Relationship / confidence	Multi Source To Oh1004 / Complex relationship
Protein identity (%)	31.200
Protein coverage (%)	TK1151 56.938 / OH-1004 25.780 Coverage and evidence Coverage is the aligned span of the best-scoring HSP divided by representative protein length. A homolog match does not establish functional validation.
Source version	TK1151 / GWHBCHF00000000

Open Full ID Mapping

SNP / Indel variants and carrier samplesCRA009020 · TK1151

Expand to load variant records for this gene.

Basic Information and Functional Annotation

Gene ID	`TkA02G391960`
Location	Chr02:99612738-99614859 (+)
Description	Similar to CHUP1: Protein CHUP1, chloroplastic
Arabidopsis / Rice Reference Genes and Papers	Download references for this gene Arabidopsis No hit for this species in the current source table. Rice No hit for this species in the current source table.
Functional annotation source	View annotation sources Functional annotation source: OH1004 · `LXL04_021409` · GCA_047496595.1_OSU_TarKok_2.0. These OH1004 annotations are retrieved through ID mapping; the Arabidopsis/rice table below uses protein alignments from the query reference.
GO annotations (OH1004 source)	GO:0009902 chloroplast relocation Biological Process GO:0030041 actin filament polymerization Biological Process GO:0043622 cortical microtubule organization Biological Process GO:0048446 petal morphogenesis Biological Process GO:0048826 cotyledon morphogenesis Biological Process GO:0051211 anisotropic cell growth Biological Process GO:0071260 cellular response to mechanical stimulus Biological Process GO:0072699 protein localization to cortical microtubule cytoskeleton Biological Process GO:0090436 leaf pavement cell development Biological Process GO:0005634 nucleus Cellular Component GO:0005794 Golgi apparatus Cellular Component GO:0005829 cytosol Cellular Component
KEGG gene cross-reference	ath:AT1G48280 ath:AT3G25690 ath:AT4G04980 These KEGG gene identifiers are linked through homologous proteins; they do not establish pathway function for this gene.

Open Annotation Module

Gene expression

View expression in different studies, tissues and treatments. Results are presented separately by study and measurement unit.

View expression for this gene

Data sources and gene correspondence

Expression data come from public transcriptome studies. Reference genomes, sample metadata and measurement units are shown with the results. Ambiguous cross-reference correspondences do not select an expression record automatically; missing values do not mean zero expression.

Subcellular Localization Top 5

Computational predictions or homology annotations below do not replace localization experiments.

Cytoplasm0.383

Rank 1 · TkA02G391960 · TK1151

Nucleus0.300

Rank 2 · TkA02G391960 · TK1151

Cell membrane0.244

Rank 3 · TkA02G391960 · TK1151

Endoplasmic reticulum0.087

Rank 4 · TkA02G391960 · TK1151

Plastid0.066

Rank 5 · TkA02G391960 · TK1151

LocPro · Direct prediction · Computational prediction, not experimental localization

Open Subcellular Module

Predicted Functional Domains

Domain results are from Pfam-A/HMMER; positions are amino-acid coordinates on the protein sequence.

PF07544Med956-130 aa

PF26095CC_Bre162-112 aa

PF25450Rab11-FIP363-112 aa

PF24161CCDC3966-304 aa

PF02996Prefoldin66-104 aa

PF13747DUF416468-112 aa

PF04859DUF64169-112 aa

PF06818Fez171-172 aa

Gene ID	Domain ID	Domain Name	Start aa	End aa	E-value	Score
TkA02G391960	`PF07544`	Med9	56	130	0.068	13.9
TkA02G391960	`PF26095`	CC_Bre1	62	112	0.025	15.6
TkA02G391960	`PF25450`	Rab11-FIP3	63	112	1.1	10.3
TkA02G391960	`PF24161`	CCDC39	66	304	0.32	9.5
TkA02G391960	`PF02996`	Prefoldin	66	104	0.89	10.2
TkA02G391960	`PF13747`	DUF4164	68	112	0.027	15.6
TkA02G391960	`PF04859`	DUF641	69	112	3.1	8.9
TkA02G391960	`PF06818`	Fez1	71	172	0.15	13.3
TkA02G391960	`PF13851`	GAS	71	170	5.2	7.1
TkA02G391960	`PF13600`	DUF4140	71	104	5.6	8.2
TkA02G391960	`PF05615`	THOC7	73	104	0.1	13.6
TkA02G391960	`PF19220`	Rod_CreS	74	168	0.5	10.2
TkA02G391960	`PF02996`	Prefoldin	76	161	0.89	10.2
TkA02G391960	`PF05377`	FlaC_arch	78	116	0.045	14.9
TkA02G391960	`PF08653`	DASH_Dam1	87	113	1.5	9.4
TkA02G391960	`PF20438`	SpoIVA_middle	103	198	5.6	7.8

Arabidopsis / Rice Protein Homology

Only Arabidopsis and rice are shown. Swiss-Prot entries are reviewed; TrEMBL entries are supplementary sequence candidates. Similarity is not experimental validation.

Download current result

No result was found for this query.

JBrowse

View in Genome Browser

Gene Card