TkA02G376420 | RubberDandelionOmics

Gene overview

TkA02G376420

Reference: TK1151 Chr: Chr02 Coordinates: 95774492-95779864 Strand: - Type: protein_coding

cDNA / CDS / Protein Sequences

Available sequence downloads CDS FASTA Protein FASTA cDNA FASTA

cDNA

2444 bp · TkA02G376420|TK1151|cDNA

GTCACAAGTTTTTGCAGAGCTATGGATAATTTAAAGATCTAGAAAAGTAAGGCTGTGTTGCTTGTACGTTTTGTATAAAAGTATGTACCTCTCACATACGACGAGAGTAGCAGCAGACACATAGCCTGCTTTGCTCTCCCCCACCCCCTTCTCTCTCCATTGAAACCTCTAATCAGCACTCGATTTTTCAATAGTCTTTCCGTGCAAAATGTCAGGCCTCAGATTTCACTTTCTCCATCTCCGATGCAAGTAATCTTCAT...

CDS

Download CDS FASTA

1302 bp · TkA02G376420|TK1151|CDS

ATGGATCAATACGAAGTGCTTGAGCAAATTGGAAAGGGGGCATTTGGTGCTGCCCTTCTTGTACGCCATAAACATGAAAGAAAAAAGTATGTGTTGAAAAAGATACGCCTTGCCCGCCAAACTGATAGAACACGTAGGTCTGCACATCAGGAGATGGAGCTTATTTCTAAAATGCGGAATCCCTTTATTGTGGAGTATAAAGATTCATGGGTTGAAAAGGGATGTTATGTATGCATTATTATAGGTTATTGCGAAGGTGG...

Protein

Download Protein FASTA

433 aa · TkA02G376420|TK1151|PROTEIN

MDQYEVLEQIGKGAFGAALLVRHKHERKKYVLKKIRLARQTDRTRRSAHQEMELISKMRNPFIVEYKDSWVEKGCYVCIIIGYCEGGDMAGAIKKANGMLFSEEKLCKWLVQLLMALDYLHLNHVLHRDVKCSNIFLTKDQDIRLGDFGLAKMLTSDDLASSVVGTPSYMCPELLADIPYGSKSDIWSLGCCIYEMTSHKAAFKAFDMQALINKINKSIVAPLPVKYTGAFRGLVKSMLRKNPELRPSAADLLRHQHLQP...

Flanking Sequence Download

Sequence orientation and download details

Upstream/downstream are capped at 10000 bp per side. Negative-strand genes are reverse-complemented so the final FASTA follows transcriptional 5′→3′ orientation.

ID Mapping

Input ID	`TkA02G376420`
TK1151 ID	TkA02G376420
OH-1004 ID	LXL04_014133
Relationship / confidence	Multi Source To Oh1004 / Complex relationship
Protein identity (%)	100.000
Protein coverage (%)	TK1151 95.612 / OH-1004 69.815 Coverage and evidence Coverage is the aligned span of the best-scoring HSP divided by representative protein length. A homolog match does not establish functional validation.
Source version	TK1151 / GWHBCHF00000000

Open Full ID Mapping

SNP / Indel variants and carrier samplesCRA009020 · TK1151

Expand to load variant records for this gene.

Basic Information and Functional Annotation

Gene ID TkA02G376420

Location Chr02:95774492-95779864 (-)

Description Similar to NEK2: Serine/threonine-protein kinase Nek2

Arabidopsis / Rice Reference Genes and Papers

Download references for this gene

Arabidopsis

Reference gene ID	Possible function	Papers / DOI
`At1g54510`	May be involved in plant development processes.	No verified direct reference in this release
`At3g63280`	May be involved in plant development processes.	No verified direct reference in this release

Rice

Reference gene ID	Possible function	Papers / DOI
`Os03g0636800`	May be involved in plant development processes.	No verified direct reference in this release
`UniProt: A2ZMH2`	May be involved in plant development processes.	No verified direct reference in this release
`Os12g0604700`	May be involved in plant development processes.	No verified direct reference in this release

Functional annotation source

View annotation sources

Functional annotation source: OH1004 · LXL04_014133 · GCA_047496595.1_OSU_TarKok_2.0. These OH1004 annotations are retrieved through ID mapping; the Arabidopsis/rice table below uses protein alignments from the query reference.

GO annotations (OH1004 source)

GO:0005737 cytoplasm Cellular Component

GO:0005886 plasma membrane Cellular Component

GO:0004674 protein serine/threonine kinase activity Molecular Function

GO:0005524 ATP binding Molecular Function

GO:0106310 protein serine kinase activity Molecular Function

KEGG gene cross-reference

ath:AT1G54510

ath:AT3G04810

dosa:Os03g0636800

dosa:Os12g0604700

These KEGG gene identifiers are linked through homologous proteins; they do not establish pathway function for this gene.

Open Annotation Module

Gene expression

View expression in different studies, tissues and treatments. Results are presented separately by study and measurement unit.

View expression for this gene

Data sources and gene correspondence

Expression data come from public transcriptome studies. Reference genomes, sample metadata and measurement units are shown with the results. Ambiguous cross-reference correspondences do not select an expression record automatically; missing values do not mean zero expression.

Subcellular Localization Top 5

Computational predictions or homology annotations below do not replace localization experiments.

Cytoplasm0.683

Rank 1 · TkA02G376420 · TK1151

Nucleus0.338

Rank 2 · TkA02G376420 · TK1151

Cell membrane0.083

Rank 3 · TkA02G376420 · TK1151

Mitochondrion0.044

Rank 4 · TkA02G376420 · TK1151

Endoplasmic reticulum0.034

Rank 5 · TkA02G376420 · TK1151

LocPro · Direct prediction · Computational prediction, not experimental localization

Open Subcellular Module

Predicted Functional Domains

Domain results are from Pfam-A/HMMER; positions are amino-acid coordinates on the protein sequence.

PF00069Pkinase4-257 aa

PF07714PK_Tyr_Ser-Thr6-254 aa

PF03109ABC182-157 aa

PF17667Pkinase_fungal88-179 aa

PF14531Kinase-like111-244 aa

Gene ID	Domain ID	Domain Name	Start aa	End aa	E-value	Score
TkA02G376420	`PF00069`	Pkinase	4	257	3.1e-62	211.1
TkA02G376420	`PF07714`	PK_Tyr_Ser-Thr	6	254	5.4e-37	128.2
TkA02G376420	`PF03109`	ABC1	82	157	0.00088	19.2
TkA02G376420	`PF17667`	Pkinase_fungal	88	179	0.00099	18.7
TkA02G376420	`PF14531`	Kinase-like	111	244	0.00016	21.7

Arabidopsis / Rice Protein Homology

Only Arabidopsis and rice are shown. Swiss-Prot entries are reviewed; TrEMBL entries are supplementary sequence candidates. Similarity is not experimental validation.

Download current result

Protein	Organism	Description	Identity	Database	Confidence
`Q9SLI2`	Arabidopsis thaliana	sp\|Q9SLI2\|NEK1_ARATH Serine/threonine-protein kinase Nek1	72.100%	Swiss-Prot	High
`Q8RXT4`	Arabidopsis thaliana	sp\|Q8RXT4\|NEK4_ARATH Serine/threonine-protein kinase Nek4	68.500%	Swiss-Prot	High
`Q10GB1`	Oryza sativa subsp. japonica	sp\|Q10GB1\|NEK1_ORYSJ Serine/threonine-protein kinase Nek1	66.400%	Swiss-Prot	High
`A2ZMH2`	Oryza sativa subsp. indica	sp\|A2ZMH2\|NEK2_ORYSI Serine/threonine-protein kinase Nek2	76.200%	Swiss-Prot	High
`Q2QMH1`	Oryza sativa subsp. japonica	sp\|Q2QMH1\|NEK2_ORYSJ Serine/threonine-protein kinase Nek2	76.200%	Swiss-Prot	High

JBrowse

View in Genome Browser

Gene Card