TkA02G373320 | RubberDandelionOmics

Gene overview

TkA02G373320

Reference: TK1151 Chr: Chr02 Coordinates: 95027579-95037370 Strand: + Type: protein_coding

cDNA / CDS / Protein Sequences

Available sequence downloads CDS FASTA Protein FASTA cDNA FASTA

cDNA

4046 bp · TkA02G373320|TK1151|cDNA

AAGCTTTTTCCCCTCTCCTCTGTAAATTGCAAAAACCCCAGCGCTGTTTTAGTACCTTCATACGGTTTCTGGTTGGAGTCTCATCTCTCGTTCGTTCGTAGCTGTCGAACTTCTGCCATTCGATCTAATCATAATCTCGATCGAGATGAATGGAGGATATGTAAACGGCGAATTAGGTCAGCTTCAAGCCACTATGCAAACAATCGAAATTGCTTGCAGCTCTATTCAGATTAATGTAAATCCATTGGCTGCTGAGGCAA...

CDS

Download CDS FASTA

3468 bp · TkA02G373320|TK1151|CDS

ATGAATGGAGGATATGTAAACGGCGAATTAGGTCAGCTTCAAGCCACTATGCAAACAATCGAAATTGCTTGCAGCTCTATTCAGATTAATGTAAATCCATTGGCTGCTGAGGCAACTATATTGTCTCTATGCCAGTCTGCTCGACCATACCATGCATGCCAGTTTATTATTGAAAATTCTCAAATGGCAAATGCAAGATTTCAGGCAGCCACAGCAATTCGAGATGCAGCTATAAGAGAATGGTCAATCCTTTCACATGA...

Protein

Download Protein FASTA

1155 aa · TkA02G373320|TK1151|PROTEIN

MNGGYVNGELGQLQATMQTIEIACSSIQINVNPLAAEATILSLCQSARPYHACQFIIENSQMANARFQAATAIRDAAIREWSILSHDEKKSLISFCLSYVMKHASSPEGYVLSKISSVAAQLMKRGWLELTAGEKEGFFSEISMAVSGNHGLDVQFIGINFLESLVSEFSPSTSTAMSLPREFHEQCRKSLEHDYLKNFYCWALGAAQSVTTAITNSDGAESEARVCSTALRFMLQVLNWDFSSSGKVAKNTIDVYSFVA...

Flanking Sequence Download

Sequence orientation and download details

Upstream/downstream are capped at 10000 bp per side. Negative-strand genes are reverse-complemented so the final FASTA follows transcriptional 5′→3′ orientation.

ID Mapping

Input ID	`TkA02G373320`
TK1151 ID	TkA02G373320
OH-1004 ID	LXL04_023355
Relationship / confidence	Non Reciprocal Best Hit / Complex relationship
Protein identity (%)	53.600
Protein coverage (%)	TK1151 5.974 / OH-1004 18.213 Coverage and evidence Coverage is the aligned span of the best-scoring HSP divided by representative protein length. A homolog match does not establish functional validation.
Source version	TK1151 / GWHBCHF00000000

Open Full ID Mapping

SNP / Indel variants and carrier samplesCRA009020 · TK1151

Expand to load variant records for this gene.

Basic Information and Functional Annotation

Gene ID	`TkA02G373320`
Location	Chr02:95027579-95037370 (+)
Description	Similar to mcts1: Malignant T-cell-amplified sequence 1 homolog
Arabidopsis / Rice Reference Genes and Papers	Download references for this gene Arabidopsis No hit for this species in the current source table. Rice No hit for this species in the current source table.
Functional annotation source	View annotation sources Functional annotation source: OH1004 · `LXL04_023355` · GCA_047496595.1_OSU_TarKok_2.0. These OH1004 annotations are retrieved through ID mapping; the Arabidopsis/rice table below uses protein alignments from the query reference.
GO annotations (OH1004 source)	GO:0001731 formation of translation preinitiation complex Biological Process GO:0002188 translation reinitiation Biological Process GO:0006351 DNA-templated transcription Biological Process GO:0006974 DNA damage response Biological Process GO:0032790 ribosome disassembly Biological Process GO:0075522 IRES-dependent viral translational initiation Biological Process GO:0005737 cytoplasm Cellular Component GO:0005829 cytosol Cellular Component GO:0000339 RNA cap binding Molecular Function GO:0003723 RNA binding Molecular Function GO:0003743 translation initiation factor activity Molecular Function GO:0043024 ribosomal small subunit binding Molecular Function
KEGG gene cross-reference	bta:508412 ddi:DDB_G0271910 hsa:28985 mmu:66405 mmu:68995 These KEGG gene identifiers are linked through homologous proteins; they do not establish pathway function for this gene.

Open Annotation Module

Gene expression

View expression in different studies, tissues and treatments. Results are presented separately by study and measurement unit.

View expression for this gene

Data sources and gene correspondence

Expression data come from public transcriptome studies. Reference genomes, sample metadata and measurement units are shown with the results. Ambiguous cross-reference correspondences do not select an expression record automatically; missing values do not mean zero expression.

Subcellular Localization Top 5

Computational predictions or homology annotations below do not replace localization experiments.

Nucleus0.737

Rank 1 · TkA02G373320 · TK1151

Cytoplasm0.417

Rank 2 · TkA02G373320 · TK1151

Golgi apparatus0.028

Rank 3 · TkA02G373320 · TK1151

Cell membrane0.026

Rank 4 · TkA02G373320 · TK1151

Endoplasmic reticulum0.025

Rank 5 · TkA02G373320 · TK1151

LocPro · Direct prediction · Computational prediction, not experimental localization

Open Subcellular Module

Predicted Functional Domains

Domain results are from Pfam-A/HMMER; positions are amino-acid coordinates on the protein sequence.

PF28490XPO416-350 aa

PF28490XPO4485-1152 aa

PF08767CRM1_C750-897 aa

PF01480PWI852-901 aa

PF26714TPR_XPO6_C890-922 aa

PF08767CRM1_C951-1014 aa

PF26714TPR_XPO6_C987-1018 aa

PF01480PWI1001-1017 aa

Gene ID	Domain ID	Domain Name	Start aa	End aa	E-value	Score
TkA02G373320	`PF28490`	XPO4	16	350	2.3e-75	255.2
TkA02G373320	`PF28490`	XPO4	485	1152	2.3e-75	255.2
TkA02G373320	`PF08767`	CRM1_C	750	897	0.0029	17.6
TkA02G373320	`PF01480`	PWI	852	901	0.053	14.6
TkA02G373320	`PF26714`	TPR_XPO6_C	890	922	0.43	11.4
TkA02G373320	`PF08767`	CRM1_C	951	1014	0.0029	17.6
TkA02G373320	`PF26714`	TPR_XPO6_C	987	1018	0.43	11.4
TkA02G373320	`PF01480`	PWI	1001	1017	0.053	14.6
TkA02G373320	`PF26714`	TPR_XPO6_C	1047	1151	0.43	11.4
TkA02G373320	`PF08767`	CRM1_C	1132	1151	0.0029	17.6

Arabidopsis / Rice Protein Homology

Only Arabidopsis and rice are shown. Swiss-Prot entries are reviewed; TrEMBL entries are supplementary sequence candidates. Similarity is not experimental validation.

Download current result

No result was found for this query.

JBrowse

View in Genome Browser

Gene Card