TkA02G357940 | RubberDandelionOmics

Gene overview

TkA02G357940

Reference: TK1151 Chr: Chr02 Coordinates: 90923009-90924453 Strand: + Type: protein_coding

cDNA / CDS / Protein Sequences

Available sequence downloads CDS FASTA Protein FASTA cDNA FASTA

cDNA

1269 bp · TkA02G357940|TK1151|cDNA

AAAGTAATATAGGTAATTGGTAAATTTGCGATTCCATCCTTTTTCCCCAGAGTTCACGCCTCCGCCCAGTGTCGCCGATCTAGACATTGCCTTGCTGCTGTGTGCCTGTGTCTATTGGATTCCAGACGTTTCTCCAATTTTTGTTGAGAATATAATGTCTGCGACCAATTCATCAACGGAAGACTTACCGGAAGATGTGATGTTTGAAATTCTGTCAAGACTTCCGGTGAAGACAATCATCCATTGCAAGTGCGTATGCA...

CDS

Download CDS FASTA

663 bp · TkA02G357940|TK1151|CDS

ATGTCTGCGACCAATTCATCAACGGAAGACTTACCGGAAGATGTGATGTTTGAAATTCTGTCAAGACTTCCGGTGAAGACAATCATCCATTGCAAGTGCGTATGCAAGAAGTGGCTGGATCTGCAGGTTTCATCTTCTTACTTTGCCAATCTCCACTTCTCGAGATCACCTTCAGGCATCATGATGCATCATGAGCCGGTGGGTCCATACAGGGGTTCCGAACCTGAAATTTTGAAGTGGGTGGAGGTTGAAGATGAACT...

Protein

Download Protein FASTA

220 aa · TkA02G357940|TK1151|PROTEIN

MSATNSSTEDLPEDVMFEILSRLPVKTIIHCKCVCKKWLDLQVSSSYFANLHFSRSPSGIMMHHEPVGPYRGSEPEILKWVEVEDELRHLHHLHHQSLMTLDLNLPPNIETLPGGSVGGLLCLWKYGEERASSYICNPITREYMIIPLPFPGQPAFHPAKGIFASSFGVGLLTHEYKVLRVFDHENSTSTDSLFEAHVYTLGTGQWRSLGHIPKRLFMSM

Flanking Sequence Download

Sequence orientation and download details

Upstream/downstream are capped at 10000 bp per side. Negative-strand genes are reverse-complemented so the final FASTA follows transcriptional 5′→3′ orientation.

ID Mapping

Input ID	`TkA02G357940`
TK1151 ID	TkA02G357940
OH-1004 ID	LXL04_017647
Relationship / confidence	Non Reciprocal Best Hit / Complex relationship
Protein identity (%)	57.900
Protein coverage (%)	TK1151 93.182 / OH-1004 54.167 Coverage and evidence Coverage is the aligned span of the best-scoring HSP divided by representative protein length. A homolog match does not establish functional validation.
Source version	TK1151 / GWHBCHF00000000

Open Full ID Mapping

SNP / Indel variants and carrier samplesCRA009020 · TK1151

Expand to load variant records for this gene.

Basic Information and Functional Annotation

Gene ID TkA02G357940

Location Chr02:90923009-90924453 (+)

Description Similar to At3g07870: F-box protein At3g07870

Arabidopsis / Rice Reference Genes and Papers

Download references for this gene

Arabidopsis

Reference gene ID	Possible function	Papers / DOI
`At3g52320`	Putative F-box protein At3g52320.	No verified direct reference in this release
`At5g52610`	Putative F-box protein At5g52610.	No verified direct reference in this release
`At3g07870`	F-box protein At3g07870.	No verified direct reference in this release
`At1g30920`	Putative F-box protein At1g30920.	No verified direct reference in this release
`At2g16220`	Putative F-box protein At2g16220.	No verified direct reference in this release

Rice

No hit for this species in the current source table.

Functional annotation source

View annotation sources

Functional annotation source: OH1004 · LXL04_017647 · GCA_047496595.1_OSU_TarKok_2.0. These OH1004 annotations are retrieved through ID mapping; the Arabidopsis/rice table below uses protein alignments from the query reference.

GO annotations (OH1004 source)

GO:0008284 positive regulation of cell population proliferation Biological Process

GO:0009626 plant-type hypersensitive response Biological Process

GO:0016567 protein ubiquitination Biological Process

GO:0031348 negative regulation of defense response Biological Process

GO:0042177 negative regulation of protein catabolic process Biological Process

GO:0005634 nucleus Cellular Component

GO:0005737 cytoplasm Cellular Component

GO:0009506 plasmodesma Cellular Component

KEGG gene cross-reference

ath:AT3G06240

ath:AT3G07870

ath:AT3G17540

ath:AT3G23880

ath:AT4G12560

These KEGG gene identifiers are linked through homologous proteins; they do not establish pathway function for this gene.

Open Annotation Module

Gene expression

View expression in different studies, tissues and treatments. Results are presented separately by study and measurement unit.

View expression for this gene

Data sources and gene correspondence

Expression data come from public transcriptome studies. Reference genomes, sample metadata and measurement units are shown with the results. Ambiguous cross-reference correspondences do not select an expression record automatically; missing values do not mean zero expression.

Subcellular Localization Top 5

Computational predictions or homology annotations below do not replace localization experiments.

Cytoplasm0.512

Rank 1 · TkA02G357940 · TK1151

Nucleus0.403

Rank 2 · TkA02G357940 · TK1151

Cell membrane0.151

Rank 3 · TkA02G357940 · TK1151

Endoplasmic reticulum0.102

Rank 4 · TkA02G357940 · TK1151

Lysosome / Vacuole0.052

Rank 5 · TkA02G357940 · TK1151

LocPro · Direct prediction · Computational prediction, not experimental localization

Open Subcellular Module

Predicted Functional Domains

Domain results are from Pfam-A/HMMER; positions are amino-acid coordinates on the protein sequence.

PF12937F-box-like9-45 aa

PF00646F-box10-41 aa

PF08268FBA_397-209 aa

PF24750b-prop_At3g26010-like108-208 aa

PF07734FBA_1119-214 aa

Gene ID	Domain ID	Domain Name	Start aa	End aa	E-value	Score
TkA02G357940	`PF12937`	F-box-like	9	45	8.3e-09	35.8
TkA02G357940	`PF00646`	F-box	10	41	3.3e-10	40.2
TkA02G357940	`PF08268`	FBA_3	97	209	7.9e-10	39.0
TkA02G357940	`PF24750`	b-prop_At3g26010-like	108	208	4.1e-05	23.6
TkA02G357940	`PF07734`	FBA_1	119	214	1.9e-05	24.6

Arabidopsis / Rice Protein Homology

Only Arabidopsis and rice are shown. Swiss-Prot entries are reviewed; TrEMBL entries are supplementary sequence candidates. Similarity is not experimental validation.

Download current result

Protein	Organism	Description	Identity	Database	Confidence
`Q9FT50`	Arabidopsis thaliana	sp\|Q9FT50\|FB202_ARATH Putative F-box protein At3g52320	29.000%	Swiss-Prot	Low
`Q9LTF6`	Arabidopsis thaliana	sp\|Q9LTF6\|FB291_ARATH Putative F-box protein At5g52610	29.200%	Swiss-Prot	Low
`Q9SFC7`	Arabidopsis thaliana	sp\|Q9SFC7\|FB135_ARATH F-box protein At3g07870	25.700%	Swiss-Prot	Low
`P0C2G2`	Arabidopsis thaliana	sp\|P0C2G2\|FB21_ARATH Putative F-box protein At1g30920	27.200%	Swiss-Prot	Low
`Q8S8C7`	Arabidopsis thaliana	sp\|Q8S8C7\|FB105_ARATH Putative F-box protein At2g16220	30.500%	Swiss-Prot	Medium

JBrowse

View in Genome Browser

Gene Card