TkA02G347120 | RubberDandelionOmics

Gene overview

TkA02G347120

Reference: TK1151 Chr: Chr02 Coordinates: 88189826-88195230 Strand: - Type: protein_coding

cDNA / CDS / Protein Sequences

Available sequence downloads CDS FASTA Protein FASTA cDNA FASTA

cDNA

2401 bp · TkA02G347120|TK1151|cDNA

TACTATTCGCGTATCTTCGATAAAATTATAATCTTACTAAAGTCTAAACCCTCATTTCAAAACGCCTGTTCTGAAATAGACCGAGACAAGAAAAAGGGGGGAAAAGCTATGGAAACGGACGACTGGGGTTTTAGCGCGGAGGAGCTAGATTCCCTCGAAAAGGATGCTCTCAACCGGATCGCTCAACGAAAAGCCAGTACCACCACCGCCACCACCACCACCGCCACCACGAGTACCAGGGCTCATGCCCCTTCAACGTT...

CDS

Download CDS FASTA

2211 bp · TkA02G347120|TK1151|CDS

TACTATTCGCGTATCTTCGATAAAATTATAATCTTACTAAAGTCTAAACCCTCATTTCAAAACGCCTGTTCTGAAATAGACCGAGACAAGAAAAAGGGGGGAAAAGCTATGGAAACGGACGACTGGGGTTTTAGCGCGGAGGAGCTAGATTCCCTCGAAAAGGATGCTCTCAACCGGATCGCTCAACGAAAAGCCAGTACCACCACCGCCACCACCACCACCGCCACCACGAGTACCAGGGCTCATGCCCCTTCAACGTT...

Protein

Download Protein FASTA

736 aa · TkA02G347120|TK1151|PROTEIN

YYSRIFDKIIILLKSKPSFQNACSEIDRDKKKGGKAMETDDWGFSAEELDSLEKDALNRIAQRKASTTTATTTTATTSTRAHAPSTFYNNSNTRLLPSTAKPAFEFRNAHKVNTMPTASGNPSAVRKASGDESSKTRSIKFYLHASGNVAAKFAYDQVLVGALRKIPRATWHAKERLWMFPLVSLPAAEKVLGELSGSNIEVESLDPLLQRAISAASTVPDLQDRYESMPDCIKLKLLPFQQEGVRFILQHGGRVLLADE...

Flanking Sequence Download

Sequence orientation and download details

Upstream/downstream are capped at 10000 bp per side. Negative-strand genes are reverse-complemented so the final FASTA follows transcriptional 5′→3′ orientation.

ID Mapping

Input ID	`TkA02G347120`
TK1151 ID	TkA02G347120
OH-1004 ID	LXL04_015320
Relationship / confidence	Rbh High Identity Coverage Synteny / Strict
Protein identity (%)	98.600
Protein coverage (%)	TK1151 99.864 / OH-1004 98.525 Coverage and evidence Coverage is the aligned span of the best-scoring HSP divided by representative protein length. A homolog match does not establish functional validation.
Source version	TK1151 / GWHBCHF00000000

Open Full ID Mapping

SNP / Indel variants and carrier samplesCRA009020 · TK1151

Expand to load variant records for this gene.

Basic Information and Functional Annotation

Gene ID	`TkA02G347120`
Location	Chr02:88189826-88195230 (-)
Description	Similar to smarcal1: SWI/SNF-related matrix-associated actin-dependent regulator of chromatin subfamily A-like protein 1
Arabidopsis / Rice Reference Genes and Papers	Download references for this gene Arabidopsis No hit for this species in the current source table. Rice No hit for this species in the current source table.
Functional annotation source	View annotation sources Functional annotation source: OH1004 · `LXL04_015320` · GCA_047496595.1_OSU_TarKok_2.0. These OH1004 annotations are retrieved through ID mapping; the Arabidopsis/rice table below uses protein alignments from the query reference.
GO annotations (OH1004 source)	GO:0000278 mitotic cell cycle Biological Process GO:0006281 DNA repair Biological Process GO:0006303 double-strand break repair via nonhomologous end joining Biological Process GO:0006357 regulation of transcription by RNA polymerase II Biological Process GO:0006974 DNA damage response Biological Process GO:0009411 response to UV Biological Process GO:0010172 embryonic body morphogenesis Biological Process GO:0031297 replication fork processing Biological Process GO:0048589 developmental growth Biological Process GO:0071932 replication fork reversal Biological Process GO:0090656 t-circle formation Biological Process GO:0005634 nucleus Cellular Component
KEGG gene cross-reference	dre:560412 hsa:50485 mmu:226409 xtr:780385 These KEGG gene identifiers are linked through homologous proteins; they do not establish pathway function for this gene.

Open Annotation Module

Gene expression

View expression in different studies, tissues and treatments. Results are presented separately by study and measurement unit.

View expression for this gene

Data sources and gene correspondence

Expression data come from public transcriptome studies. Reference genomes, sample metadata and measurement units are shown with the results. Ambiguous cross-reference correspondences do not select an expression record automatically; missing values do not mean zero expression.

Subcellular Localization Top 5

Computational predictions or homology annotations below do not replace localization experiments.

Nucleus0.793

Rank 1 · TkA02G347120 · TK1151

Cytoplasm0.212

Rank 2 · TkA02G347120 · TK1151

Mitochondrion0.074

Rank 3 · TkA02G347120 · TK1151

Cell membrane0.025

Rank 4 · TkA02G347120 · TK1151

Endoplasmic reticulum0.016

Rank 5 · TkA02G347120 · TK1151

LocPro · Direct prediction · Computational prediction, not experimental localization

Open Subcellular Module

Predicted Functional Domains

Domain results are from Pfam-A/HMMER; positions are amino-acid coordinates on the protein sequence.

PF04851ResIII235-400 aa

PF00176SNF2-rel_dom240-512 aa

PF04851ResIII534-567 aa

PF00271Helicase_C540-646 aa

PF16203ERCC3_RAD25_C550-638 aa

PF10496Syntaxin-18_N691-725 aa

Gene ID	Domain ID	Domain Name	Start aa	End aa	E-value	Score
TkA02G347120	`PF04851`	ResIII	235	400	1.2e-05	26.0
TkA02G347120	`PF00176`	SNF2-rel_dom	240	512	2.9e-34	119.2
TkA02G347120	`PF04851`	ResIII	534	567	1.2e-05	26.0
TkA02G347120	`PF00271`	Helicase_C	540	646	2.5e-19	70.3
TkA02G347120	`PF16203`	ERCC3_RAD25_C	550	638	0.11	12.4
TkA02G347120	`PF10496`	Syntaxin-18_N	691	725	0.15	13.0

Arabidopsis / Rice Protein Homology

Only Arabidopsis and rice are shown. Swiss-Prot entries are reviewed; TrEMBL entries are supplementary sequence candidates. Similarity is not experimental validation.

Download current result

No result was found for this query.

JBrowse

View in Genome Browser

Gene Card