TkA02G346460 | RubberDandelionOmics

Gene overview

TkA02G346460

Reference: TK1151 Chr: Chr02 Coordinates: 87973119-87974058 Strand: - Type: protein_coding

cDNA / CDS / Protein Sequences

Available sequence downloads CDS FASTA Protein FASTA cDNA FASTA

cDNA

768 bp · TkA02G346460|TK1151|cDNA

ATGGATGATATCTCGCTTTTCCACCTGGCGTCTCGCGTCAATCCAAACCCATCACCCGCCGGAGCACCCATGAAGCTCGCATTCATGTTCCTCACCACCGGCCCGCTGCCATTTACGCCACTCTGGGAGCTCTACTTCAATCGCACCCGAACAAAACATTTATACAATATATACATACACGCCGACCCTAATCTCCGATACGACCAGATATTTCAAGGAGTTTTCAGCAACCGGACGATTCCCTCAAAACCAACGCGACG...

CDS

Download CDS FASTA

768 bp · TkA02G346460|TK1151|CDS

ATGGATGATATCTCGCTTTTCCACCTGGCGTCTCGCGTCAATCCAAACCCATCACCCGCCGGAGCACCCATGAAGCTCGCATTCATGTTCCTCACCACCGGCCCGCTGCCATTTACGCCACTCTGGGAGCTCTACTTCAATCGCACCCGAACAAAACATTTATACAATATATACATACACGCCGACCCTAATCTCCGATACGACCAGATATTTCAAGGAGTTTTCAGCAACCGGACGATTCCCTCAAAACCAACGCGACG...

Protein

Download Protein FASTA

255 aa · TkA02G346460|TK1151|PROTEIN

MDDISLFHLASRVNPNPSPAGAPMKLAFMFLTTGPLPFTPLWELYFNRTRTKHLYNIYIHADPNLRYDQIFQGVFSNRTIPSKPTRRNTPTLAAAHRRLLATALLHDPSNYIAHRDSRERSWRVGKMGCAWRNLMLPEVEFQRFRIGSQFSVLTRHHARVVVGDTRLWSSLSWPCLRDIDRRGHRGHPYTFPASDVSPEFIRKLRRRRPRYGDEEINGSDTSVIQRNDPFLFARKFGADAVGALVEIADDVVLRE

Flanking Sequence Download

Sequence orientation and download details

Upstream/downstream are capped at 10000 bp per side. Negative-strand genes are reverse-complemented so the final FASTA follows transcriptional 5′→3′ orientation.

ID Mapping

Input ID	`TkA02G346460`
TK1151 ID	TkA02G346460
OH-1004 ID	LXL04_001390
Relationship / confidence	Multi Source To Oh1004 / Complex relationship
Protein identity (%)	72.500
Protein coverage (%)	TK1151 100.000 / OH-1004 86.501 Coverage and evidence Coverage is the aligned span of the best-scoring HSP divided by representative protein length. A homolog match does not establish functional validation.
Source version	TK1151 / GWHBCHF00000000

Open Full ID Mapping

SNP / Indel variants and carrier samplesCRA009020 · TK1151

Expand to load variant records for this gene.

Basic Information and Functional Annotation

Gene ID	`TkA02G346460`
Location	Chr02:87973119-87974058 (-)
Description	Similar to BC10: Glycosyltransferase BC10
Arabidopsis / Rice Reference Genes and Papers	Download references for this gene Arabidopsis No hit for this species in the current source table. Rice No hit for this species in the current source table.
Functional annotation source	View annotation sources Functional annotation source: OH1004 · `LXL04_001390` · GCA_047496595.1_OSU_TarKok_2.0. These OH1004 annotations are retrieved through ID mapping; the Arabidopsis/rice table below uses protein alignments from the query reference.
GO annotations (OH1004 source)	GO:0009664 plant-type cell wall organization Biological Process GO:0030244 cellulose biosynthetic process Biological Process GO:0000139 Golgi membrane Cellular Component GO:0016757 glycosyltransferase activity Molecular Function
KEGG gene cross-reference	dosa:Os05g0170000 osa:4337935 These KEGG gene identifiers are linked through homologous proteins; they do not establish pathway function for this gene.

Open Annotation Module

Gene expression

View expression in different studies, tissues and treatments. Results are presented separately by study and measurement unit.

View expression for this gene

Data sources and gene correspondence

Expression data come from public transcriptome studies. Reference genomes, sample metadata and measurement units are shown with the results. Ambiguous cross-reference correspondences do not select an expression record automatically; missing values do not mean zero expression.

Subcellular Localization Top 5

Computational predictions or homology annotations below do not replace localization experiments.

Golgi apparatus0.311

Rank 1 · TkA02G346460 · TK1151

Extracellular0.226

Rank 2 · TkA02G346460 · TK1151

Endoplasmic reticulum0.168

Rank 3 · TkA02G346460 · TK1151

Cell membrane0.115

Rank 4 · TkA02G346460 · TK1151

Cytoplasm0.105

Rank 5 · TkA02G346460 · TK1151

LocPro · Direct prediction · Computational prediction, not experimental localization

Open Subcellular Module

Predicted Functional Domains

Domain results are from Pfam-A/HMMER; positions are amino-acid coordinates on the protein sequence.

PF02485Branch26-111 aa

PF02485Branch125-175 aa

PF02485Branch183-205 aa

Gene ID	Domain ID	Domain Name	Start aa	End aa	E-value	Score
TkA02G346460	`PF02485`	Branch	26	111	3.9e-27	96.1
TkA02G346460	`PF02485`	Branch	125	175	3.9e-27	96.1
TkA02G346460	`PF02485`	Branch	183	205	3.9e-27	96.1

Arabidopsis / Rice Protein Homology

Only Arabidopsis and rice are shown. Swiss-Prot entries are reviewed; TrEMBL entries are supplementary sequence candidates. Similarity is not experimental validation.

Download current result

No result was found for this query.

JBrowse

View in Genome Browser

Gene Card