Gene Card
Gene overview
cDNA / CDS / Protein Sequences
2000 bp · TkA02G344130|TK1151|cDNA
GAACAGTTGGGCTTCTCAAGTATAAGATCGAACCCTAATTTTGACCTCAGGACCAGGCCCATGCCCATGAGTGGTTTCGATCCTTCGACCATCGGACCCTGTTCCGACTTCCGATCTATCTTGTGTCAAACTTCTTTGGAATCAGATCATACAATTCTCTCTCTCTAGCTCTCGTTCTCGCACACATAAACCCTTAATAAACCTCTGCTATGTATACGATACTTGGTTTCGGCCAAACATGAAGAGGGTATTTAGAATAT...
1533 bp · TkA02G344130|TK1151|CDS
ATGAAGAGGGTATTTAGAATATCTGAGATTACAGCAGCAAAATCGGAGCTGCTGTATTGCCACACTAAAATTTCCGTACCCAAATGCCTAACGAATCCAACTACAATACCCACCTCTACCCGATGGTTTTCTACCGAAGAAACCCATTCATTATCATCCAAAACCATGTCAGACTTGTATGGACAGTTTGCTGATAAATGGGCTTACGCCGAGGTGCGAGCTAAAGAAGAATTGATTAAAAAAGTATCTGTATTCCGAGA...
Protein
Download Protein FASTA510 aa · TkA02G344130|TK1151|PROTEIN
MKRVFRISEITAAKSELLYCHTKISVPKCLTNPTTIPTSTRWFSTEETHSLSSKTMSDLYGQFADKWAYAEVRAKEELIKKVSVFRDELMKNVKDDISFENLLEVKGLKLFKRYSNGAALLELLRLLESNPHLAIKVFNWRREQENKPMSPEEYAKGIKIAGRMKNVGYALELFTEATQKRIKNTSTYNALMGVYMWNGLTEKCLSVYRELIQDINCHPTSATFNMLISIYGYRVLIDQMETAFQEMRDSNIAPTLTTYN...
Flanking Sequence Download
Sequence orientation and download details
Upstream/downstream are capped at 10000 bp per side. Negative-strand genes are reverse-complemented so the final FASTA follows transcriptional 5′→3′ orientation.
ID Mapping
| Input ID | TkA02G344130 |
|---|---|
| TK1151 ID | TkA02G344130 |
| OH-1004 ID | LXL04_008488 |
| Relationship / confidence | Non Reciprocal Best Hit / Complex relationship |
| Protein identity (%) | 27.400 |
| Protein coverage (%) | TK1151 20.000 / OH-1004 16.044Coverage and evidenceCoverage is the aligned span of the best-scoring HSP divided by representative protein length. A homolog match does not establish functional validation. |
| Source version | TK1151 / GWHBCHF00000000 |
SNP / Indel variants and carrier samplesCRA009020 · TK1151
Expand to load variant records for this gene.
Basic Information and Functional Annotation
| Gene ID | TkA02G344130 | |||||||||
|---|---|---|---|---|---|---|---|---|---|---|
| Location | Chr02:87389652-87393152 (+) | |||||||||
| Description | Similar to At3g16010: Pentatricopeptide repeat-containing protein At3g16010 | |||||||||
| Arabidopsis / Rice Reference Genes and Papers |
Download references for this gene Arabidopsis
RiceNo hit for this species in the current source table. | |||||||||
| Functional annotation source | View annotation sourcesFunctional annotation source: OH1004 · | |||||||||
| GO annotations (OH1004 source) | GO:0000373 Group II intron splicing Biological Process GO:0000963 mitochondrial RNA processing Biological Process GO:0032981 mitochondrial respiratory chain complex I assembly Biological Process GO:0005739 mitochondrion Cellular Component GO:0009507 chloroplast Cellular Component GO:0003729 mRNA binding Molecular Function | |||||||||
| KEGG gene cross-reference | ath:AT3G06920 ath:AT3G16010 These KEGG gene identifiers are linked through homologous proteins; they do not establish pathway function for this gene. |
Gene expression
View expression in different studies, tissues and treatments. Results are presented separately by study and measurement unit.
Data sources and gene correspondence
Expression data come from public transcriptome studies. Reference genomes, sample metadata and measurement units are shown with the results. Ambiguous cross-reference correspondences do not select an expression record automatically; missing values do not mean zero expression.
Subcellular Localization Top 5
Computational predictions or homology annotations below do not replace localization experiments.
LocPro · Direct prediction · Computational prediction, not experimental localization
Predicted Functional Domains
Domain results are from Pfam-A/HMMER; positions are amino-acid coordinates on the protein sequence.
PF13812PPR_3127-144 aaPF13041PPR_2130-148 aaPF17177PPR_long142-305 aaPF29070MSC6_N152-274 aaPF23276TPR_24159-280 aaPF01535PPR162-177 aaPF13812PPR_3162-195 aaPF13041PPR_2163-179 aa| Gene ID | Domain ID | Domain Name | Start aa | End aa | E-value | Score |
|---|---|---|---|---|---|---|
| TkA02G344130 | PF13812 | PPR_3 | 127 | 144 | 7.3e-11 | 42.7 |
| TkA02G344130 | PF13041 | PPR_2 | 130 | 148 | 5.3e-19 | 68.8 |
| TkA02G344130 | PF17177 | PPR_long | 142 | 305 | 7.9e-05 | 22.8 |
| TkA02G344130 | PF29070 | MSC6_N | 152 | 274 | 9.2e-10 | 38.9 |
| TkA02G344130 | PF23276 | TPR_24 | 159 | 280 | 0.051 | 14.2 |
| TkA02G344130 | PF01535 | PPR | 162 | 177 | 3.9e-13 | 49.4 |
| TkA02G344130 | PF13812 | PPR_3 | 162 | 195 | 7.3e-11 | 42.7 |
| TkA02G344130 | PF13041 | PPR_2 | 163 | 179 | 5.3e-19 | 68.8 |
| TkA02G344130 | PF12854 | PPR_1 | 167 | 176 | 0.34 | 11.4 |
| TkA02G344130 | PF13812 | PPR_3 | 174 | 233 | 7.3e-11 | 42.7 |
| TkA02G344130 | PF13041 | PPR_2 | 183 | 229 | 5.3e-19 | 68.8 |
| TkA02G344130 | PF12854 | PPR_1 | 184 | 192 | 0.34 | 11.4 |
| TkA02G344130 | PF01535 | PPR | 186 | 213 | 3.9e-13 | 49.4 |
| TkA02G344130 | PF12854 | PPR_1 | 216 | 229 | 0.34 | 11.4 |
| TkA02G344130 | PF13041 | PPR_2 | 219 | 266 | 5.3e-19 | 68.8 |
| TkA02G344130 | PF01535 | PPR | 223 | 252 | 3.9e-13 | 49.4 |
Arabidopsis / Rice Protein Homology
Only Arabidopsis and rice are shown. Swiss-Prot entries are reviewed; TrEMBL entries are supplementary sequence candidates. Similarity is not experimental validation.