TkA02G340240 | RubberDandelionOmics

Gene overview

TkA02G340240

Reference: TK1151 Chr: Chr02 Coordinates: 86394164-86398414 Strand: + Type: protein_coding

cDNA / CDS / Protein Sequences

Available sequence downloads CDS FASTA Protein FASTA cDNA FASTA

cDNA

1038 bp · TkA02G340240|TK1151|cDNA

TCAAAACCTCTCTCGAACACAACACAGTCTCTTTTTTTTCTCTGTTTATTTGAAGCAGTGAGCTCGGTGAAGACAATGGCTACATCATCATCGCCGCCGCCGCAAACCGACAGTGAAGTGGTGGCAGAACGGAGGGGAATACCTGCGGCTTCTTTTGTTAAAGACGTCCAAGCTTATTTGAATCAATTAGGTCTTGATGTTAACTCTACTCTCGCCTTCCTCCAAGAAAGGCTTCAGCAATACAAAGTGGTTGAGATGAA...

CDS

Download CDS FASTA

756 bp · TkA02G340240|TK1151|CDS

ATGGCTACATCATCATCGCCGCCGCCGCAAACCGACAGTGAAGTGGTGGCAGAACGGAGGGGAATACCTGCGGCTTCTTTTGTTAAAGACGTCCAAGCTTATTTGAATCAATTAGGTCTTGATGTTAACTCTACTCTCGCCTTCCTCCAAGAAAGGCTTCAGCAATACAAAGTGGTTGAGATGAAACTTCTTGCTCAACAGAGAGATCTTCAGGCAAAGATTCCAGATATTGAGAAATGTTTAGATGTGGTTGCTACTTT...

Protein

Download Protein FASTA

251 aa · TkA02G340240|TK1151|PROTEIN

MATSSSPPPQTDSEVVAERRGIPAASFVKDVQAYLNQLGLDVNSTLAFLQERLQQYKVVEMKLLAQQRDLQAKIPDIEKCLDVVATLQAKKDSDEALLTDFEVSEGIYSRARIENTDSVCLWLGANVMLEYSCEEVHILLFITNTLYSFFTNIGSDIAIAKELGKCKASLEVLVGDLQFLRDQVTITQKKSGHYEEEVSEEGEFVPNTFDEEIQNEKNELEEEVLKENGYANQQEVTPAMNNSQFIVKEIL

Flanking Sequence Download

Sequence orientation and download details

Upstream/downstream are capped at 10000 bp per side. Negative-strand genes are reverse-complemented so the final FASTA follows transcriptional 5′→3′ orientation.

ID Mapping

Input ID	`TkA02G340240`
TK1151 ID	TkA02G340240
OH-1004 ID	LXL04_015379
Relationship / confidence	Rbh Below Probable Coverage Or Synteny Threshold / Review
Protein identity (%)	85.100
Protein coverage (%)	TK1151 100.000 / OH-1004 100.000 Coverage and evidence Coverage is the aligned span of the best-scoring HSP divided by representative protein length. A homolog match does not establish functional validation.
Source version	TK1151 / GWHBCHF00000000

Open Full ID Mapping

SNP / Indel variants and carrier samplesCRA009020 · TK1151

Expand to load variant records for this gene.

Basic Information and Functional Annotation

Gene ID TkA02G340240

Location Chr02:86394164-86398414 (+)

Description Similar to At5g49510: Probable prefoldin subunit 3

Arabidopsis / Rice Reference Genes and Papers

Download references for this gene

Arabidopsis

Reference gene ID	Possible function	Papers / DOI
`At5g49510`	Binds specifically to cytosolic chaperonin (c-CPN) and transfers target proteins to it.	Prefoldins 3 and 5 play an essential role in Arabidopsis tolerance to salt stress.2009 · DOI: 10.1093/mp/ssp016

Rice

No hit for this species in the current source table.

Functional annotation source

View annotation sources

Functional annotation source: OH1004 · LXL04_015379 · GCA_047496595.1_OSU_TarKok_2.0. These OH1004 annotations are retrieved through ID mapping; the Arabidopsis/rice table below uses protein alignments from the query reference.

GO annotations (OH1004 source)

GO:0006397 mRNA processing Biological Process

GO:0006457 protein folding Biological Process

GO:0007017 microtubule-based process Biological Process

GO:0007021 tubulin complex assembly Biological Process

GO:0009409 response to cold Biological Process

GO:0009631 cold acclimation Biological Process

GO:0009651 response to salt stress Biological Process

GO:0043622 cortical microtubule organization Biological Process

GO:0050821 protein stabilization Biological Process

GO:0071370 cellular response to gibberellin stimulus Biological Process

GO:1905907 negative regulation of amyloid fibril formation Biological Process

GO:0005634 nucleus Cellular Component

KEGG gene cross-reference

ath:AT5G49510

bta:508727

hsa:7411

mmu:22327

pon:100190860

These KEGG gene identifiers are linked through homologous proteins; they do not establish pathway function for this gene.

Open Annotation Module

Gene expression

View expression in different studies, tissues and treatments. Results are presented separately by study and measurement unit.

View expression for this gene

Data sources and gene correspondence

Expression data come from public transcriptome studies. Reference genomes, sample metadata and measurement units are shown with the results. Ambiguous cross-reference correspondences do not select an expression record automatically; missing values do not mean zero expression.

Subcellular Localization Top 5

Computational predictions or homology annotations below do not replace localization experiments.

Cytoplasm0.599

Rank 1 · TkA02G340240 · TK1151

Nucleus0.338

Rank 2 · TkA02G340240 · TK1151

Golgi apparatus0.113

Rank 3 · TkA02G340240 · TK1151

Endoplasmic reticulum0.093

Rank 4 · TkA02G340240 · TK1151

Cell membrane0.089

Rank 5 · TkA02G340240 · TK1151

LocPro · Direct prediction · Computational prediction, not experimental localization

Open Subcellular Module

Predicted Functional Domains

Domain results are from Pfam-A/HMMER; positions are amino-acid coordinates on the protein sequence.

PF05859Mis1242-216 aa

PF02996Prefoldin57-135 aa

PF02996Prefoldin159-189 aa

PF02996Prefoldin214-222 aa

Gene ID	Domain ID	Domain Name	Start aa	End aa	E-value	Score
TkA02G340240	`PF05859`	Mis12	42	216	0.002	18.6
TkA02G340240	`PF02996`	Prefoldin	57	135	3.1e-18	66.6
TkA02G340240	`PF02996`	Prefoldin	159	189	3.1e-18	66.6
TkA02G340240	`PF02996`	Prefoldin	214	222	3.1e-18	66.6

Arabidopsis / Rice Protein Homology

Only Arabidopsis and rice are shown. Swiss-Prot entries are reviewed; TrEMBL entries are supplementary sequence candidates. Similarity is not experimental validation.

Download current result

Protein	Organism	Description	Identity	Database	Confidence
`P57741`	Arabidopsis thaliana	sp\|P57741\|PFD3_ARATH Prefoldin subunit 3	69.200%	Swiss-Prot	High

JBrowse

View in Genome Browser

Gene Card