TkA02G331710 | RubberDandelionOmics

Gene overview

TkA02G331710

Reference: TK1151 Chr: Chr02 Coordinates: 84186231-84188006 Strand: + Type: protein_coding

cDNA / CDS / Protein Sequences

Available sequence downloads CDS FASTA Protein FASTA cDNA FASTA

cDNA

1206 bp · TkA02G331710|TK1151|cDNA

ATGCGGTGTAAAGGTCGTGAAGATAAAGAAGGTGAAATTAAGGAAGACAATGTTAAGCTCATTGCGGATAAACTAATGGAAAGTGAACAGCAAATAAAAGATGGAAAACTAATACTTGAGTCGGGGACGGATACCATGAGCTTAGTTTTTGGCCAAGAGAAGGGCAGATTTTTAAAGGGTGTGGGAACCGGAGTGACTGCCACCAGATTTTTCCATATCCCTCGCAACAAAGGAACAACTAAGCAGGAAATTAAGGACCT...

CDS

Download CDS FASTA

1206 bp · TkA02G331710|TK1151|CDS

ATGCGGTGTAAAGGTCGTGAAGATAAAGAAGGTGAAATTAAGGAAGACAATGTTAAGCTCATTGCGGATAAACTAATGGAAAGTGAACAGCAAATAAAAGATGGAAAACTAATACTTGAGTCGGGGACGGATACCATGAGCTTAGTTTTTGGCCAAGAGAAGGGCAGATTTTTAAAGGGTGTGGGAACCGGAGTGACTGCCACCAGATTTTTCCATATCCCTCGCAACAAAGGAACAACTAAGCAGGAAATTAAGGACCT...

Protein

Download Protein FASTA

401 aa · TkA02G331710|TK1151|PROTEIN

MRCKGREDKEGEIKEDNVKLIADKLMESEQQIKDGKLILESGTDTMSLVFGQEKGRFLKGVGTGVTATRFFHIPRNKGTTKQEIKDLKCAVQTKDIELEKKNAEVKSLSTKFDEQEETLKLVLAHLAATGVNLQNIRKTFVLQLENVAESHGTADINISKEPTDEPLTPAIRNTINKTVQNKSVATIHDTPSPSITPALSKTTKKVFAPKTATTIPDVPAISTKKPLNQQIMCSLSYPDKRNIVARGEIHLSSQRQLIHG...

Flanking Sequence Download

Sequence orientation and download details

Upstream/downstream are capped at 10000 bp per side. Negative-strand genes are reverse-complemented so the final FASTA follows transcriptional 5′→3′ orientation.

ID Mapping

Input ID	`TkA02G331710`
TK1151 ID	TkA02G331710
OH-1004 ID	LXL04_034503
Relationship / confidence	Multi Source To Oh1004 / Complex relationship
Protein identity (%)	72.900
Protein coverage (%)	TK1151 100.000 / OH-1004 61.613 Coverage and evidence Coverage is the aligned span of the best-scoring HSP divided by representative protein length. A homolog match does not establish functional validation.
Source version	TK1151 / GWHBCHF00000000

Open Full ID Mapping

SNP / Indel variants and carrier samplesCRA009020 · TK1151

Expand to load variant records for this gene.

Basic Information and Functional Annotation

Gene ID	`TkA02G331710`
Location	Chr02:84186231-84188006 (+)
Description	Similar to COP1: E3 ubiquitin-protein ligase COP1
Arabidopsis / Rice Reference Genes and Papers	Download references for this gene Arabidopsis No hit for this species in the current source table. Rice No hit for this species in the current source table.
Functional annotation source	View annotation sources Functional annotation source: OH1004 · `LXL04_034503` · GCA_047496595.1_OSU_TarKok_2.0. These OH1004 annotations are retrieved through ID mapping; the Arabidopsis/rice table below uses protein alignments from the query reference.
GO annotations (OH1004 source)	GO:0006281 DNA repair Biological Process GO:0006511 ubiquitin-dependent protein catabolic process Biological Process GO:0009585 red, far-red light phototransduction Biological Process GO:0009637 response to blue light Biological Process GO:0009640 photomorphogenesis Biological Process GO:0009641 shade avoidance Biological Process GO:0009647 skotomorphogenesis Biological Process GO:0009649 entrainment of circadian clock Biological Process GO:0009963 positive regulation of flavonoid biosynthetic process Biological Process GO:0010119 regulation of stomatal movement Biological Process GO:0010212 response to ionizing radiation Biological Process GO:0010224 response to UV-B Biological Process
KEGG gene cross-reference	ath:AT1G53090 ath:AT2G32950 hsa:64326 mmu:26374 These KEGG gene identifiers are linked through homologous proteins; they do not establish pathway function for this gene.

Open Annotation Module

Gene expression

View expression in different studies, tissues and treatments. Results are presented separately by study and measurement unit.

View expression for this gene

Data sources and gene correspondence

Expression data come from public transcriptome studies. Reference genomes, sample metadata and measurement units are shown with the results. Ambiguous cross-reference correspondences do not select an expression record automatically; missing values do not mean zero expression.

Subcellular Localization Top 5

Computational predictions or homology annotations below do not replace localization experiments.

Nucleus0.923

Rank 1 · TkA02G331710 · TK1151

Cytoplasm0.139

Rank 2 · TkA02G331710 · TK1151

Mitochondrion0.023

Rank 3 · TkA02G331710 · TK1151

Cell membrane0.017

Rank 4 · TkA02G331710 · TK1151

Extracellular0.011

Rank 5 · TkA02G331710 · TK1151

LocPro · Direct prediction · Computational prediction, not experimental localization

Open Subcellular Module

Predicted Functional Domains

Domain results are from Pfam-A/HMMER; positions are amino-acid coordinates on the protein sequence.

PF09012FeoC18-33 aa

PF14069SpoVIF73-101 aa

PF26133DUF803975-109 aa

PF01519DUF1678-135 aa

PF00038Filament79-130 aa

PF16516CC2-LZ79-120 aa

PF09012FeoC99-130 aa

PF27652ARMC6_N102-141 aa

Gene ID	Domain ID	Domain Name	Start aa	End aa	E-value	Score
TkA02G331710	`PF09012`	FeoC	18	33	0.13	13.1
TkA02G331710	`PF14069`	SpoVIF	73	101	1.5	9.3
TkA02G331710	`PF26133`	DUF8039	75	109	1.9e-15	57.8
TkA02G331710	`PF01519`	DUF16	78	135	0.029	15.6
TkA02G331710	`PF00038`	Filament	79	130	0.0033	17.8
TkA02G331710	`PF16516`	CC2-LZ	79	120	0.093	13.9
TkA02G331710	`PF09012`	FeoC	99	130	0.13	13.1
TkA02G331710	`PF27652`	ARMC6_N	102	141	0.061	13.9
TkA02G331710	`PF26133`	DUF8039	142	161	1.9e-15	57.8
TkA02G331710	`PF26133`	DUF8039	227	308	1.9e-15	57.8
TkA02G331710	`PF03017`	Transposase_23	240	295	0.00036	21.0
TkA02G331710	`PF14069`	SpoVIF	328	361	1.5	9.3

Arabidopsis / Rice Protein Homology

Only Arabidopsis and rice are shown. Swiss-Prot entries are reviewed; TrEMBL entries are supplementary sequence candidates. Similarity is not experimental validation.

Download current result

No result was found for this query.

JBrowse

View in Genome Browser

Gene Card