TkA02G329440 | RubberDandelionOmics

Gene overview

TkA02G329440

Reference: TK1151 Chr: Chr02 Coordinates: 83572890-83578533 Strand: + Type: protein_coding

cDNA / CDS / Protein Sequences

Available sequence downloads CDS FASTA Protein FASTA cDNA FASTA

cDNA

2154 bp · TkA02G329440|TK1151|cDNA

CAGCGAGTCGTTAGCGAGATGCCGCGGGGCGGTGTTTCCATCCTCGCTAAGGCTTAGCGAGCCTCTTAGCGAGATCGACTCCGCGCAGCCTAACTAGACCAAGAAGTATCTAGACGCAAATGTCATATCATTCCCGCTAAAACTCTCAACCAATGTCTGCCGCAGAGAACCTTAATTCTCTTCGCCTTCAACAAGCCCTAGGTTCATGTTCCCAGTCGATCACTAATGGGGACTTCAAGCAATCCCAAGAATCCATATCG...

CDS

Download CDS FASTA

1785 bp · TkA02G329440|TK1151|CDS

ATGTCTGCCGCAGAGAACCTTAATTCTCTTCGCCTTCAACAAGCCCTAGGTTCATGTTCCCAGTCGATCACTAATGGGGACTTCAAGCAATCCCAAGAATCCATATCGGAGCTTGTCCATTTGCTTGATTCAGTATCGGATTTCATCTCATCTGGGACTGAAGATGAAGAAGAATCAGAGAAATCGGCATTTGAAGTTCTTTCAGAAATTTATTGCTACTTAATTTCACCTTCGCTTGACCAGGCCATTACAGATGCATT...

Protein

Download Protein FASTA

594 aa · TkA02G329440|TK1151|PROTEIN

MSAAENLNSLRLQQALGSCSQSITNGDFKQSQESISELVHLLDSVSDFISSGTEDEEESEKSAFEVLSEIYCYLISPSLDQAITDALAFELPKAVAKLACVSTRCFENAERIIYHFVERCSPRDMVSILCEAMTSSTDNFNNSFYFTPLLGALAKVFEALKRRPFEQVKAALPVVLKVLDTILKDPEEEEDTAFMDLLNKSILIASSIKAICIKLDHKDEKLLALLGLYVLQITALISNSVGSETSRWSPMMLQLSHFLH...

Flanking Sequence Download

Sequence orientation and download details

Upstream/downstream are capped at 10000 bp per side. Negative-strand genes are reverse-complemented so the final FASTA follows transcriptional 5′→3′ orientation.

ID Mapping

Input ID	`TkA02G329440`
TK1151 ID	TkA02G329440
OH-1004 ID	LXL04_015462
Relationship / confidence	Rbh High Identity Coverage Synteny / Strict
Protein identity (%)	98.800
Protein coverage (%)	TK1151 100.000 / OH-1004 100.000 Coverage and evidence Coverage is the aligned span of the best-scoring HSP divided by representative protein length. A homolog match does not establish functional validation.
Source version	TK1151 / GWHBCHF00000000

Open Full ID Mapping

SNP / Indel variants and carrier samplesCRA009020 · TK1151

Expand to load variant records for this gene.

Basic Information and Functional Annotation

Gene ID TkA02G329440

Location Chr02:83572890-83578533 (+)

Description Similar to ALF4: Aberrant root formation protein 4

Arabidopsis / Rice Reference Genes and Papers

Download references for this gene

Arabidopsis

Reference gene ID	Possible function	Papers / DOI
`At5g11030`	Required for the initiation of lateral roots independent from auxin signaling.	Arabidopsis ALF4 encodes a nuclear-localized protein required for lateral root formation.2004 · DOI: 10.1046/j.1365-313x.2003.01964.x

Rice

No hit for this species in the current source table.

Functional annotation source

View annotation sources

Functional annotation source: OH1004 · LXL04_015462 · GCA_047496595.1_OSU_TarKok_2.0. These OH1004 annotations are retrieved through ID mapping; the Arabidopsis/rice table below uses protein alignments from the query reference.

GO annotations (OH1004 source)

GO:0005634 nucleus Cellular Component

GO:0005737 cytoplasm Cellular Component

GO:0009507 chloroplast Cellular Component

GO:0055105 ubiquitin-protein transferase inhibitor activity Molecular Function

KEGG gene cross-reference

ath:AT5G11030

These KEGG gene identifiers are linked through homologous proteins; they do not establish pathway function for this gene.

Open Annotation Module

Gene expression

View expression in different studies, tissues and treatments. Results are presented separately by study and measurement unit.

View expression for this gene

Data sources and gene correspondence

Expression data come from public transcriptome studies. Reference genomes, sample metadata and measurement units are shown with the results. Ambiguous cross-reference correspondences do not select an expression record automatically; missing values do not mean zero expression.

Subcellular Localization Top 5

Computational predictions or homology annotations below do not replace localization experiments.

Nucleus0.503

Rank 1 · TkA02G329440 · TK1151

Cytoplasm0.464

Rank 2 · TkA02G329440 · TK1151

Golgi apparatus0.087

Rank 3 · TkA02G329440 · TK1151

Endoplasmic reticulum0.066

Rank 4 · TkA02G329440 · TK1151

Cell membrane0.056

Rank 5 · TkA02G329440 · TK1151

LocPro · Direct prediction · Computational prediction, not experimental localization

Open Subcellular Module

Predicted Functional Domains

Domain results are from Pfam-A/HMMER; positions are amino-acid coordinates on the protein sequence.

PF08568Kinetochor_Ybp257-193 aa

PF08568Kinetochor_Ybp2391-562 aa

Gene ID	Domain ID	Domain Name	Start aa	End aa	E-value	Score
TkA02G329440	`PF08568`	Kinetochor_Ybp2	57	193	9e-32	111.1
TkA02G329440	`PF08568`	Kinetochor_Ybp2	391	562	9e-32	111.1

Arabidopsis / Rice Protein Homology

Only Arabidopsis and rice are shown. Swiss-Prot entries are reviewed; TrEMBL entries are supplementary sequence candidates. Similarity is not experimental validation.

Download current result

Protein	Organism	Description	Identity	Database	Confidence
`Q84VX3`	Arabidopsis thaliana	sp\|Q84VX3\|ALF4_ARATH Aberrant root formation protein 4	42.200%	Swiss-Prot	Medium

JBrowse

View in Genome Browser

Gene Card