TkA02G327670 | RubberDandelionOmics

Gene overview

TkA02G327670

Reference: TK1151 Chr: Chr02 Coordinates: 83133725-83139401 Strand: - Type: protein_coding

cDNA / CDS / Protein Sequences

Available sequence downloads CDS FASTA Protein FASTA cDNA FASTA

cDNA

2148 bp · TkA02G327670|TK1151|cDNA

AAAAAAAACGTTTTAAACCCTATATGCTACATCTCTGTCCTCTGACAGTTCTACACCACATTTCTTTTTTCTTTCTCTCACTCACTCTCTCTCTCTCCTTCACATCACTTTTGTTTCCGCTCAAAATTCCGTTCGCTCGAGCAAAAAACCAGGGTCGCAAAGTATTTGAAAATTTGTTCAAATTCCCCGAGAGAACTTTAAATTCACAATGCAATTAACCAAACACACAACCCCATTTGCTTTTCTGTTTCTTCTTCTTG...

CDS

Download CDS FASTA

1629 bp · TkA02G327670|TK1151|CDS

ATGCAATTAACCAAACACACAACCCCATTTGCTTTTCTGTTTCTTCTTCTTGCTCTATTCTTCATTTTCTCAAATGGAGAACCCTATTCGTCTACCTTCAGGACACCCACTTCAGGAGAAAATCGAAGGGGGGATAATAATTTTTTGGAAACGTGGGGTACGAAACGGTTACTCGCCGAAGAACAGTATGATGTGAATTCATCACTTGTGTTGGCTGAAAAAAGAACAGCAAGAAAAGATCCACTCGATGGTTTAAAGAA...

Protein

Download Protein FASTA

542 aa · TkA02G327670|TK1151|PROTEIN

MQLTKHTTPFAFLFLLLALFFIFSNGEPYSSTFRTPTSGENRRGDNNFLETWGTKRLLAEEQYDVNSSLVLAEKRTARKDPLDGLKKYRGGWNISERHYWGSVAFTAAPFFIMAIAWFVLFGLSLAIICLCYCCCTREPYGYSKLAYALSLILLILFTVVAIVGCVVLYTGQGKFHHSTDETLSYIVKQADMTAEKLRNLSDDLESAKKVGVAQVFLPVQVQEDIDEIQIKLNTSSYALSEKTEDNKDKIHHVLNIVMLV...

Flanking Sequence Download

Sequence orientation and download details

Upstream/downstream are capped at 10000 bp per side. Negative-strand genes are reverse-complemented so the final FASTA follows transcriptional 5′→3′ orientation.

ID Mapping

Input ID	`TkA02G327670`
TK1151 ID	TkA02G327670
OH-1004 ID	LXL04_015473
Relationship / confidence	Rbh High Identity Coverage Synteny / Strict
Protein identity (%)	98.200
Protein coverage (%)	TK1151 99.815 / OH-1004 99.815 Coverage and evidence Coverage is the aligned span of the best-scoring HSP divided by representative protein length. A homolog match does not establish functional validation.
Source version	TK1151 / GWHBCHF00000000

Open Full ID Mapping

SNP / Indel variants and carrier samplesCRA009020 · TK1151

Expand to load variant records for this gene.

Basic Information and Functional Annotation

Gene ID	`TkA02G327670`
Location	Chr02:83133725-83139401 (-)
Description	Protein of unknown function
Arabidopsis / Rice Reference Genes and Papers	Download references for this gene Arabidopsis No hit for this species in the current source table. Rice No hit for this species in the current source table.
Functional annotation source	View annotation sources Functional annotation source: OH1004 · `LXL04_015473` · GCA_047496595.1_OSU_TarKok_2.0. These OH1004 annotations are retrieved through ID mapping; the Arabidopsis/rice table below uses protein alignments from the query reference.
GO annotations (OH1004 source)	No functional description available
KEGG gene cross-reference	No functional description available

Open Annotation Module

Gene expression

View expression in different studies, tissues and treatments. Results are presented separately by study and measurement unit.

View expression for this gene

Data sources and gene correspondence

Expression data come from public transcriptome studies. Reference genomes, sample metadata and measurement units are shown with the results. Ambiguous cross-reference correspondences do not select an expression record automatically; missing values do not mean zero expression.

Subcellular Localization Top 5

Computational predictions or homology annotations below do not replace localization experiments.

Cell membrane0.558

Rank 1 · TkA02G327670 · TK1151

Lysosome / Vacuole0.257

Rank 2 · TkA02G327670 · TK1151

Cytoplasm0.166

Rank 3 · TkA02G327670 · TK1151

Endoplasmic reticulum0.088

Rank 4 · TkA02G327670 · TK1151

Golgi apparatus0.066

Rank 5 · TkA02G327670 · TK1151

LocPro · Direct prediction · Computational prediction, not experimental localization

Open Subcellular Module

Predicted Functional Domains

Domain results are from Pfam-A/HMMER; positions are amino-acid coordinates on the protein sequence.

PF06687SUR77-23 aa

PF07331TctB11-23 aa

PF00335Tetraspanin12-22 aa

PF04547Anoctamin51-160 aa

PF00487FA_desaturase70-132 aa

PF07331TctB96-160 aa

PF04906Tweety97-368 aa

PF20990DUF2207_C100-182 aa

Gene ID	Domain ID	Domain Name	Start aa	End aa	E-value	Score
TkA02G327670	`PF06687`	SUR7	7	23	0.018	15.4
TkA02G327670	`PF07331`	TctB	11	23	0.0011	19.8
TkA02G327670	`PF00335`	Tetraspanin	12	22	5.1e-07	30.3
TkA02G327670	`PF04547`	Anoctamin	51	160	4.4	6.8
TkA02G327670	`PF00487`	FA_desaturase	70	132	0.88	10.0
TkA02G327670	`PF07331`	TctB	96	160	0.0011	19.8
TkA02G327670	`PF04906`	Tweety	97	368	0.44	9.9
TkA02G327670	`PF20990`	DUF2207_C	100	182	0.16	12.4
TkA02G327670	`PF05241`	EBP	107	179	5.2	8.2
TkA02G327670	`PF06687`	SUR7	110	177	0.018	15.4
TkA02G327670	`PF00335`	Tetraspanin	117	206	5.1e-07	30.3
TkA02G327670	`PF20237`	DUF6594	117	169	0.31	11.6
TkA02G327670	`PF04678`	MCU	117	144	2.6	8.8
TkA02G327670	`PF29008`	DDB_G0292058_C	138	374	3.2e-10	40.2
TkA02G327670	`PF26256`	DUF8060	144	170	0.24	12.1
TkA02G327670	`PF06084`	Cytomega_TRL10	152	158	1.0	10.1

Arabidopsis / Rice Protein Homology

Only Arabidopsis and rice are shown. Swiss-Prot entries are reviewed; TrEMBL entries are supplementary sequence candidates. Similarity is not experimental validation.

Download current result

No result was found for this query.

JBrowse

View in Genome Browser

Gene Card