TkA02G320280 | RubberDandelionOmics

Gene overview

TkA02G320280

Reference: TK1151 Chr: Chr02 Coordinates: 81338344-81339942 Strand: + Type: protein_coding

cDNA / CDS / Protein Sequences

Available sequence downloads CDS FASTA Protein FASTA cDNA FASTA

cDNA

1482 bp · TkA02G320280|TK1151|cDNA

ATGGAGTTGAAGTTCTCTACCTGGAAACTTGTATCACTTTTCCTAAGTCTTTCGCTTGGGTTTTTCACATCAACCACCCGTGCCGACTTTCTTGATTGCATCTCTCGTCAAATTTCACCAAATTTCACATTATCAGACATTGTTTTCACCCCTAATGACTCTTCATACTCCACAATTCTTGAATCTACCATCCAAAACCTTAGATTTGCCACCCCAACATCACCAAAACCGTCAACAATAATCACACCCTTGTCATATTC...

CDS

Download CDS FASTA

1482 bp · TkA02G320280|TK1151|CDS

ATGGAGTTGAAGTTCTCTACCTGGAAACTTGTATCACTTTTCCTAAGTCTTTCGCTTGGGTTTTTCACATCAACCACCCGTGCCGACTTTCTTGATTGCATCTCTCGTCAAATTTCACCAAATTTCACATTATCAGACATTGTTTTCACCCCTAATGACTCTTCATACTCCACAATTCTTGAATCTACCATCCAAAACCTTAGATTTGCCACCCCAACATCACCAAAACCGTCAACAATAATCACACCCTTGTCATATTC...

Protein

Download Protein FASTA

493 aa · TkA02G320280|TK1151|PROTEIN

MELKFSTWKLVSLFLSLSLGFFTSTTRADFLDCISRQISPNFTLSDIVFTPNDSSYSTILESTIQNLRFATPTSPKPSTIITPLSYSHVQSTVTCSVESQLQIRIRSGGHDYEGLSYTSHDQTPFILLDLNKLRSVTVDLDDKTAWVESGATLGELSYWVSQKSNVLGFPTGECTSVGVGGQLSGGGYGTMARKYGLSSDNVIDALIVDVNGRILDRNSMGEDLFWAIRGGGGGSFGVVLSWKIKLVDVPPIVTVFSLSK...

Flanking Sequence Download

Sequence orientation and download details

Upstream/downstream are capped at 10000 bp per side. Negative-strand genes are reverse-complemented so the final FASTA follows transcriptional 5′→3′ orientation.

ID Mapping

Input ID	`TkA02G320280`
TK1151 ID	TkA02G320280
OH-1004 ID	LXL04_015528
Relationship / confidence	Rbh High Identity Coverage Synteny / Strict
Protein identity (%)	95.600
Protein coverage (%)	TK1151 100.000 / OH-1004 100.000 Coverage and evidence Coverage is the aligned span of the best-scoring HSP divided by representative protein length. A homolog match does not establish functional validation.
Source version	TK1151 / GWHBCHF00000000

Open Full ID Mapping

SNP / Indel variants and carrier samplesCRA009020 · TK1151

Expand to load variant records for this gene.

Basic Information and Functional Annotation

Gene ID TkA02G320280

Location Chr02:81338344-81339942 (+)

Description Similar to At5g44400: Berberine bridge enzyme-like 26

Arabidopsis / Rice Reference Genes and Papers

Download references for this gene

Arabidopsis

Reference gene ID	Possible function	Papers / DOI
`At4g20820`	Berberine bridge enzyme-like 18.	No verified direct reference in this release
`At5g44400`	Berberine bridge enzyme-like 26.	No verified direct reference in this release

Rice

No hit for this species in the current source table.

Functional annotation source

View annotation sources

Functional annotation source: OH1004 · LXL04_015528 · GCA_047496595.1_OSU_TarKok_2.0. These OH1004 annotations are retrieved through ID mapping; the Arabidopsis/rice table below uses protein alignments from the query reference.

GO annotations (OH1004 source)

GO:0009793 embryo development ending in seed dormancy Biological Process

GO:0009820 alkaloid metabolic process Biological Process

GO:0010197 polar nucleus fusion Biological Process

GO:0005773 vacuole Cellular Component

GO:0005783 endoplasmic reticulum Cellular Component

GO:0009505 plant-type cell wall Cellular Component

GO:0009506 plasmodesma Cellular Component

GO:0009507 chloroplast Cellular Component

GO:0031982 vesicle Cellular Component

GO:0016491 oxidoreductase activity Molecular Function

GO:0045551 cinnamyl-alcohol dehydrogenase activity Molecular Function

GO:0050268 coniferyl-alcohol dehydrogenase activity Molecular Function

KEGG gene cross-reference

ag:ADY15026

ag:AWJ76616

ath:AT2G34790

ath:AT5G44400

These KEGG gene identifiers are linked through homologous proteins; they do not establish pathway function for this gene.

Open Annotation Module

Gene expression

View expression in different studies, tissues and treatments. Results are presented separately by study and measurement unit.

View expression for this gene

Data sources and gene correspondence

Expression data come from public transcriptome studies. Reference genomes, sample metadata and measurement units are shown with the results. Ambiguous cross-reference correspondences do not select an expression record automatically; missing values do not mean zero expression.

Subcellular Localization Top 5

Computational predictions or homology annotations below do not replace localization experiments.

Extracellular0.291

Rank 1 · TkA02G320280 · TK1151

Lysosome / Vacuole0.275

Rank 2 · TkA02G320280 · TK1151

Endoplasmic reticulum0.194

Rank 3 · TkA02G320280 · TK1151

Cytoplasm0.129

Rank 4 · TkA02G320280 · TK1151

Cell membrane0.101

Rank 5 · TkA02G320280 · TK1151

LocPro · Direct prediction · Computational prediction, not experimental localization

Open Subcellular Module

Predicted Functional Domains

Domain results are from Pfam-A/HMMER; positions are amino-acid coordinates on the protein sequence.

PF01565FAD_binding_477-216 aa

PF08031BBE319-334 aa

PF01565FAD_binding_4339-365 aa

PF08031BBE431-489 aa

Gene ID	Domain ID	Domain Name	Start aa	End aa	E-value	Score
TkA02G320280	`PF01565`	FAD_binding_4	77	216	2.6e-26	92.7
TkA02G320280	`PF08031`	BBE	319	334	1.5e-19	70.4
TkA02G320280	`PF01565`	FAD_binding_4	339	365	2.6e-26	92.7
TkA02G320280	`PF08031`	BBE	431	489	1.5e-19	70.4

Arabidopsis / Rice Protein Homology

Only Arabidopsis and rice are shown. Swiss-Prot entries are reviewed; TrEMBL entries are supplementary sequence candidates. Similarity is not experimental validation.

Download current result

Protein	Organism	Description	Identity	Database	Confidence
`Q9SVG5`	Arabidopsis thaliana	sp\|Q9SVG5\|BBE18_ARATH Berberine bridge enzyme-like 18	47.300%	Swiss-Prot	Medium
`Q9FKU8`	Arabidopsis thaliana	sp\|Q9FKU8\|BBE26_ARATH Berberine bridge enzyme-like 26	47.400%	Swiss-Prot	Medium

JBrowse

View in Genome Browser

Gene Card