TkA02G308740 | RubberDandelionOmics

Gene overview

TkA02G308740

Reference: TK1151 Chr: Chr02 Coordinates: 78578411-78581888 Strand: - Type: protein_coding

cDNA / CDS / Protein Sequences

Available sequence downloads CDS FASTA Protein FASTA cDNA FASTA

cDNA

817 bp · TkA02G308740|TK1151|cDNA

GGGTAGAAATAAATATATAGTGATGATATTATCGTGTACATGACAGGAAATAAGGTGAACAACATTGATGTTGTTTATACTCCTTGGCAAAACTTGAAGAAGACTCCATCCATGGATGTTGGTCAAGTTGGTTTCCACAACAATAAATCTGTGCGCACTGTGAGGGTGGAGAAGCGAATCAATGAGGTTGTTAATAGACTGAACAGGACAAAAGTGGAAAGAAAACCTGACCTCAAAGCTGAGCGTGAAGCAGTTAATGC...

CDS

Download CDS FASTA

648 bp · TkA02G308740|TK1151|CDS

ATGGTGTTCTACTTCAAAGCCCGACCAGAATCCGGAGACTACACCATTTTCATGGGTCTTGACAAATTCGAGAACGAAGAACTCATCAAATACGGGTTCCCCGAAGATATATGGTTTCATGTGGACAAAATGTCATCTGCCCATGTTTATCTGAGGATGCGTAAGGGTCAGACAATTGATGACATTTCTGAAGGACTTCTTGAAGATTGTGTTCAACTTGTCAAAGCTAATTCCATTCAAGGAAATAAGGTGAACAACAT...

Protein

Download Protein FASTA

215 aa · TkA02G308740|TK1151|PROTEIN

MVFYFKARPESGDYTIFMGLDKFENEELIKYGFPEDIWFHVDKMSSAHVYLRMRKGQTIDDISEGLLEDCVQLVKANSIQGNKVNNIDVVYTPWQNLKKTPSMDVGQVGFHNNKSVRTVRVEKRINEVVNRLNRTKVERKPDLKAEREAVNAAERAERKLQLRDKKRREEMERLEKERQAEVRSYKNLMVADKMTSNKEIASTHKSLQELEEDFM

Flanking Sequence Download

Sequence orientation and download details

Upstream/downstream are capped at 10000 bp per side. Negative-strand genes are reverse-complemented so the final FASTA follows transcriptional 5′→3′ orientation.

ID Mapping

Input ID	`TkA02G308740`
TK1151 ID	TkA02G308740
OH-1004 ID	LXL04_015630
Relationship / confidence	Rbh High Identity Coverage Synteny / Strict
Protein identity (%)	95.100
Protein coverage (%)	TK1151 100.000 / OH-1004 100.000 Coverage and evidence Coverage is the aligned span of the best-scoring HSP divided by representative protein length. A homolog match does not establish functional validation.
Source version	TK1151 / GWHBCHF00000000

Open Full ID Mapping

SNP / Indel variants and carrier samplesCRA009020 · TK1151

Expand to load variant records for this gene.

Basic Information and Functional Annotation

Gene ID	`TkA02G308740`
Location	Chr02:78578411-78581888 (-)
Description	Similar to ccdc25: Coiled-coil domain-containing protein 25
Arabidopsis / Rice Reference Genes and Papers	Download references for this gene Arabidopsis No hit for this species in the current source table. Rice No hit for this species in the current source table.
Functional annotation source	View annotation sources Functional annotation source: OH1004 · `LXL04_015630` · GCA_047496595.1_OSU_TarKok_2.0. These OH1004 annotations are retrieved through ID mapping; the Arabidopsis/rice table below uses protein alignments from the query reference.
GO annotations (OH1004 source)	GO:2000147 positive regulation of cell motility Biological Process GO:0005886 plasma membrane Cellular Component GO:0012505 endomembrane system Cellular Component GO:0003677 DNA binding Molecular Function
KEGG gene cross-reference	bta:507275 dre:393359 hsa:55246 mmu:67179 pon:100173172 These KEGG gene identifiers are linked through homologous proteins; they do not establish pathway function for this gene.

Open Annotation Module

Gene expression

View expression in different studies, tissues and treatments. Results are presented separately by study and measurement unit.

View expression for this gene

Data sources and gene correspondence

Expression data come from public transcriptome studies. Reference genomes, sample metadata and measurement units are shown with the results. Ambiguous cross-reference correspondences do not select an expression record automatically; missing values do not mean zero expression.

Subcellular Localization Top 5

Computational predictions or homology annotations below do not replace localization experiments.

Cytoplasm0.641

Rank 1 · TkA02G308740 · TK1151

Cell membrane0.246

Rank 2 · TkA02G308740 · TK1151

Nucleus0.192

Rank 3 · TkA02G308740 · TK1151

Golgi apparatus0.125

Rank 4 · TkA02G308740 · TK1151

Endoplasmic reticulum0.071

Rank 5 · TkA02G308740 · TK1151

LocPro · Direct prediction · Computational prediction, not experimental localization

Open Subcellular Module

Predicted Functional Domains

Domain results are from Pfam-A/HMMER; positions are amino-acid coordinates on the protein sequence.

PF05670NFACT-R_11-112 aa

PF06185YecM36-177 aa

PF11816Ubl_WDR48-Bun10772-162 aa

PF03938OmpH149-213 aa

Gene ID	Domain ID	Domain Name	Start aa	End aa	E-value	Score
TkA02G308740	`PF05670`	NFACT-R_1	1	112	9.9e-36	123.4
TkA02G308740	`PF06185`	YecM	36	177	0.027	15.0
TkA02G308740	`PF11816`	Ubl_WDR48-Bun107	72	162	0.098	13.2
TkA02G308740	`PF03938`	OmpH	149	213	0.6	11.0

Arabidopsis / Rice Protein Homology

Only Arabidopsis and rice are shown. Swiss-Prot entries are reviewed; TrEMBL entries are supplementary sequence candidates. Similarity is not experimental validation.

Download current result

No result was found for this query.

JBrowse

View in Genome Browser

Gene Card