TkA02G303550 | RubberDandelionOmics

Gene overview

TkA02G303550

Reference: TK1151 Chr: Chr02 Coordinates: 77325383-77327099 Strand: + Type: protein_coding

cDNA / CDS / Protein Sequences

Available sequence downloads CDS FASTA Protein FASTA cDNA FASTA

cDNA

1236 bp · TkA02G303550|TK1151|cDNA

ATGGATGATGGGGAAGATATGGAGGAGGATGGCGAGGATACGCTACAAGGTTCGAATAGCACAAACATACCCGCTTATGGTACTCCTCAGAGGCCTTTTATCACTTGGGTTGGGAAAAAGTTTGGAAGAAGTTTTGTGCACCGAGAGATTGGGAAGCTGGTGAATCAATATTTAGAGGGTTCGTGGATAAGTTTCAAAGAAATCCCCAAAGAAAATATTGAGCCGCTTTGGGTGCGTTTCAAGACCCTTTATGTTTGGGA...

CDS

Download CDS FASTA

1236 bp · TkA02G303550|TK1151|CDS

ATGGATGATGGGGAAGATATGGAGGAGGATGGCGAGGATACGCTACAAGGTTCGAATAGCACAAACATACCCGCTTATGGTACTCCTCAGAGGCCTTTTATCACTTGGGTTGGGAAAAAGTTTGGAAGAAGTTTTGTGCACCGAGAGATTGGGAAGCTGGTGAATCAATATTTAGAGGGTTCGTGGATAAGTTTCAAAGAAATCCCCAAAGAAAATATTGAGCCGCTTTGGGTGCGTTTCAAGACCCTTTATGTTTGGGA...

Protein

Download Protein FASTA

411 aa · TkA02G303550|TK1151|PROTEIN

MDDGEDMEEDGEDTLQGSNSTNIPAYGTPQRPFITWVGKKFGRSFVHREIGKLVNQYLEGSWISFKEIPKENIEPLWVRFKTLYVWDSTQEQRMNTNFQFVVACRYRDAMRMFRIKSALKAIKEGHPISAKGLNFDIMVHYVPRGMQSKRWVELCKQWNTVEWLKRSESGTNNRNTIDSGGKISRHTGGSICYDEHRIRLTAKLGRPPTFLELFMQTHLDKESKKKFFAGDEAAGKQFCTEKAREAYEAYSQALLEKYGD...

Flanking Sequence Download

Sequence orientation and download details

Upstream/downstream are capped at 10000 bp per side. Negative-strand genes are reverse-complemented so the final FASTA follows transcriptional 5′→3′ orientation.

ID Mapping

Input ID	`TkA02G303550`
TK1151 ID	TkA02G303550
OH-1004 ID	LXL04_013096
Relationship / confidence	Non Reciprocal Best Hit / Complex relationship
Protein identity (%)	43.400
Protein coverage (%)	TK1151 68.856 / OH-1004 78.237 Coverage and evidence Coverage is the aligned span of the best-scoring HSP divided by representative protein length. A homolog match does not establish functional validation.
Source version	TK1151 / GWHBCHF00000000

Open Full ID Mapping

SNP / Indel variants and carrier samplesCRA009020 · TK1151

Expand to load variant records for this gene.

Basic Information and Functional Annotation

Gene ID	`TkA02G303550`
Location	Chr02:77325383-77327099 (+)
Description	Protein of unknown function
Arabidopsis / Rice Reference Genes and Papers	Download references for this gene Arabidopsis No hit for this species in the current source table. Rice No hit for this species in the current source table.
Functional annotation source	View annotation sources Functional annotation source: OH1004 · `LXL04_013096` · GCA_047496595.1_OSU_TarKok_2.0. These OH1004 annotations are retrieved through ID mapping; the Arabidopsis/rice table below uses protein alignments from the query reference.
GO annotations (OH1004 source)	No functional description available
KEGG gene cross-reference	No functional description available

Open Annotation Module

Gene expression

View expression in different studies, tissues and treatments. Results are presented separately by study and measurement unit.

View expression for this gene

Data sources and gene correspondence

Expression data come from public transcriptome studies. Reference genomes, sample metadata and measurement units are shown with the results. Ambiguous cross-reference correspondences do not select an expression record automatically; missing values do not mean zero expression.

Subcellular Localization Top 5

Computational predictions or homology annotations below do not replace localization experiments.

Nucleus0.942

Rank 1 · TkA02G303550 · TK1151

Cytoplasm0.156

Rank 2 · TkA02G303550 · TK1151

Mitochondrion0.020

Rank 3 · TkA02G303550 · TK1151

Cell membrane0.015

Rank 4 · TkA02G303550 · TK1151

Extracellular0.009

Rank 5 · TkA02G303550 · TK1151

LocPro · Direct prediction · Computational prediction, not experimental localization

Open Subcellular Module

Predicted Functional Domains

Domain results are from Pfam-A/HMMER; positions are amino-acid coordinates on the protein sequence.

PF03004Transposase_24148-294 aa

PF30360Shootin295-365 aa

PF30378CEP135_TSGA10_CC309-381 aa

PF26022CC_Liprin_beta311-357 aa

PF24627PUMA_CC317-335 aa

PF20492ERM_helical319-373 aa

PF24627PUMA_CC337-367 aa

Gene ID	Domain ID	Domain Name	Start aa	End aa	E-value	Score
TkA02G303550	`PF03004`	Transposase_24	148	294	4.5e-15	56.7
TkA02G303550	`PF30360`	Shootin	295	365	0.022	14.9
TkA02G303550	`PF30378`	CEP135_TSGA10_CC	309	381	0.0066	15.5
TkA02G303550	`PF26022`	CC_Liprin_beta	311	357	0.00051	21.0
TkA02G303550	`PF24627`	PUMA_CC	317	335	0.3	11.8
TkA02G303550	`PF20492`	ERM_helical	319	373	0.2	12.5
TkA02G303550	`PF24627`	PUMA_CC	337	367	0.3	11.8

Arabidopsis / Rice Protein Homology

Only Arabidopsis and rice are shown. Swiss-Prot entries are reviewed; TrEMBL entries are supplementary sequence candidates. Similarity is not experimental validation.

Download current result

No result was found for this query.

JBrowse

View in Genome Browser

Gene Card