Gene Card
Gene overview
cDNA / CDS / Protein Sequences
1624 bp · TkA02G288000|TK1151|cDNA
TGTATATAAAGTGGAAATAATCGTAAGATGAAGGACTTGTACCGACACTGAACTTCTTCTTAACCGTGGCAATAAATGCTTGTCAACACTTTCGTCGTGTCGAAAAAACTATAACAAACCCTAACTCGCCACTGGTTTTGCTCTGAGGAACGCGATTCGGCTGAGCTCCGTTTACTTAAGATGGCAAAAGAAGATACAATTAGTGGAGAAGGAACGTCCAATGGTATAGTTAGTGATGCACCTGATACAGTCCAAGAAGT...
1284 bp · TkA02G288000|TK1151|CDS
ATGGCAAAAGAAGATACAATTAGTGGAGAAGGAACGTCCAATGGTATAGTTAGTGATGCACCTGATACAGTCCAAGAAGTGAAGGAACAAGTTGATGAATTGACGTTAGCGGACTCTTCAGAAACTGGTGTACAAGAAGCTGCAAAGAAGAAGAAGAAGAAGAACAAAAGCAAGAAGAAGAAAGAAACAAAGGAGCAAACTGATCCTCCTACTATTCCAATTGCAGACCTTTTCCCCCAAGGAAACTTTCCAGAGGGTGA...
Protein
Download Protein FASTA427 aa · TkA02G288000|TK1151|PROTEIN
MAKEDTISGEGTSNGIVSDAPDTVQEVKEQVDELTLADSSETGVQEAAKKKKKKNKSKKKKETKEQTDPPTIPIADLFPQGNFPEGEIQQYKDDNLWRTTSEEKRDLERLEKPMYDSIRQAAEVHRQVRKYVRSIIKPGMLMVDLCETLENTVRKLIQENGLQAGIAFPTGCSLNWVAAHWTPNSGDKTVLQYDDVMKLDFGTHINGHIVDCAFTVAFNPMFDPLLEASREATYTGIKEAGIDVRLCDIGAAIQEVMESY...
Flanking Sequence Download
Sequence orientation and download details
Upstream/downstream are capped at 10000 bp per side. Negative-strand genes are reverse-complemented so the final FASTA follows transcriptional 5′→3′ orientation.
ID Mapping
| Input ID | TkA02G288000 |
|---|---|
| TK1151 ID | TkA02G288000 |
| OH-1004 ID | LXL04_015770 |
| Relationship / confidence | Rbh High Identity Coverage Synteny / Strict |
| Protein identity (%) | 99.500 |
| Protein coverage (%) | TK1151 100.000 / OH-1004 96.388Coverage and evidenceCoverage is the aligned span of the best-scoring HSP divided by representative protein length. A homolog match does not establish functional validation. |
| Source version | TK1151 / GWHBCHF00000000 |
SNP / Indel variants and carrier samplesCRA009020 · TK1151
Expand to load variant records for this gene.
Basic Information and Functional Annotation
| Gene ID | TkA02G288000 | |||||||||
|---|---|---|---|---|---|---|---|---|---|---|
| Location | Chr02:73590660-73593930 (+) | |||||||||
| Description | Similar to MAP2B: Methionine aminopeptidase 2B | |||||||||
| Arabidopsis / Rice Reference Genes and Papers |
Download references for this gene Arabidopsis
RiceNo hit for this species in the current source table. | |||||||||
| Functional annotation source | View annotation sourcesFunctional annotation source: OH1004 · | |||||||||
| GO annotations (OH1004 source) | GO:0006446 regulation of translational initiation Biological Process GO:0006508 proteolysis Biological Process GO:0016485 protein processing Biological Process GO:0031365 N-terminal protein amino acid modification Biological Process GO:0005737 cytoplasm Cellular Component GO:0005829 cytosol Cellular Component GO:0005886 plasma membrane Cellular Component GO:0004177 aminopeptidase activity Molecular Function GO:0004239 initiator methionyl aminopeptidase activity Molecular Function GO:0008235 metalloexopeptidase activity Molecular Function GO:0046872 metal ion binding Molecular Function GO:0070006 metalloaminopeptidase activity Molecular Function | |||||||||
| KEGG gene cross-reference | ath:AT2G44180 ath:AT3G59990 bta:404150 mmu:56307 rno:64370 These KEGG gene identifiers are linked through homologous proteins; they do not establish pathway function for this gene. |
Gene expression
View expression in different studies, tissues and treatments. Results are presented separately by study and measurement unit.
Data sources and gene correspondence
Expression data come from public transcriptome studies. Reference genomes, sample metadata and measurement units are shown with the results. Ambiguous cross-reference correspondences do not select an expression record automatically; missing values do not mean zero expression.
Subcellular Localization Top 5
Computational predictions or homology annotations below do not replace localization experiments.
LocPro · Direct prediction · Computational prediction, not experimental localization
Predicted Functional Domains
Domain results are from Pfam-A/HMMER; positions are amino-acid coordinates on the protein sequence.
PF27971C27D6_3-like8-63 aaPF10278Med1925-66 aaPF00557Peptidase_M24117-316 aaPF10278Med19272-290 aa| Gene ID | Domain ID | Domain Name | Start aa | End aa | E-value | Score |
|---|---|---|---|---|---|---|
| TkA02G288000 | PF27971 | C27D6_3-like | 8 | 63 | 7.5 | 7.3 |
| TkA02G288000 | PF10278 | Med19 | 25 | 66 | 1.7 | 9.3 |
| TkA02G288000 | PF00557 | Peptidase_M24 | 117 | 316 | 3.9e-28 | 99.3 |
| TkA02G288000 | PF10278 | Med19 | 272 | 290 | 1.7 | 9.3 |
Arabidopsis / Rice Protein Homology
Only Arabidopsis and rice are shown. Swiss-Prot entries are reviewed; TrEMBL entries are supplementary sequence candidates. Similarity is not experimental validation.